ID: 1078251738

View in Genome Browser
Species Human (GRCh38)
Location 11:9622288-9622310
Sequence CGTTCATCCCGGTGGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078251731_1078251738 26 Left 1078251731 11:9622239-9622261 CCTTCGCCGTGAGTGTTACAGCT 0: 35
1: 1573
2: 3120
3: 2414
4: 1836
Right 1078251738 11:9622288-9622310 CGTTCATCCCGGTGGGCTCCTGG No data
1078251732_1078251738 20 Left 1078251732 11:9622245-9622267 CCGTGAGTGTTACAGCTCTTAAG 0: 40
1: 44
2: 128
3: 69
4: 182
Right 1078251738 11:9622288-9622310 CGTTCATCCCGGTGGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078251738 Original CRISPR CGTTCATCCCGGTGGGCTCC TGG Intergenic
No off target data available for this crispr