ID: 1078251903

View in Genome Browser
Species Human (GRCh38)
Location 11:9623290-9623312
Sequence CTGCTGGCTCTGGGCAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078251903_1078251912 3 Left 1078251903 11:9623290-9623312 CCCATTTTGCCCAGAGCCAGCAG No data
Right 1078251912 11:9623316-9623338 TGCCTGGCTGCTCCGAGTGCGGG No data
1078251903_1078251911 2 Left 1078251903 11:9623290-9623312 CCCATTTTGCCCAGAGCCAGCAG No data
Right 1078251911 11:9623315-9623337 CTGCCTGGCTGCTCCGAGTGCGG No data
1078251903_1078251913 4 Left 1078251903 11:9623290-9623312 CCCATTTTGCCCAGAGCCAGCAG No data
Right 1078251913 11:9623317-9623339 GCCTGGCTGCTCCGAGTGCGGGG No data
1078251903_1078251918 28 Left 1078251903 11:9623290-9623312 CCCATTTTGCCCAGAGCCAGCAG No data
Right 1078251918 11:9623341-9623363 CCACCAAGCCCACGCACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078251903 Original CRISPR CTGCTGGCTCTGGGCAAAAT GGG (reversed) Intergenic
No off target data available for this crispr