ID: 1078252262

View in Genome Browser
Species Human (GRCh38)
Location 11:9625947-9625969
Sequence CACTGTAACAAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078252262_1078252267 4 Left 1078252262 11:9625947-9625969 CCTTCTTCCCTCTTGTTACAGTG No data
Right 1078252267 11:9625974-9625996 GACAGATCTCTGCCCACTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078252262 Original CRISPR CACTGTAACAAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr