ID: 1078261016

View in Genome Browser
Species Human (GRCh38)
Location 11:9708865-9708887
Sequence AACTGCTTGTAGAACTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078261016 Original CRISPR AACTGCTTGTAGAACTCAGT AGG (reversed) Intronic
902668112 1:17953466-17953488 AGCTGCTTCTAGAACCCAGCAGG + Intergenic
905950853 1:41949334-41949356 AATAGTTTGTAGAACTGAGTAGG - Intronic
910224910 1:84926602-84926624 AACTGCTTGTCCAAGTCATTTGG + Exonic
912533387 1:110342178-110342200 AACTGCTGGGAGAACTCACAAGG - Exonic
915665011 1:157436586-157436608 AACTGCTTGTTGACCGCAATAGG - Intergenic
916129388 1:161598952-161598974 AAATGCTTAAAGATCTCAGTTGG + Intronic
918761313 1:188413517-188413539 GTCTGGTTGTAGCACTCAGTGGG - Intergenic
1064651306 10:17512686-17512708 AACTGCTTTGAGAACTGAGGTGG - Intergenic
1064937237 10:20691755-20691777 AAATGCTTGTTGAACTGAATTGG - Intergenic
1069229460 10:65990861-65990883 AACTGCTTGAAGAAAACATTGGG - Intronic
1074641349 10:115386475-115386497 AACTGTTTACAGCACTCAGTGGG - Intronic
1076259210 10:129052281-129052303 AGCAGCTTGTAGAACACATTTGG - Intergenic
1078261016 11:9708865-9708887 AACTGCTTGTAGAACTCAGTAGG - Intronic
1078400965 11:11026607-11026629 TACAGCTAGTAGAACTCAATTGG - Intergenic
1081854896 11:46296869-46296891 AACTGCTTAGAGAGCTCAGCTGG - Intronic
1087475686 11:98631013-98631035 AACTGTTTACAGAACTCAGCAGG - Intergenic
1089459511 11:118644421-118644443 AACTGCTTGTTGACCTGAGTCGG + Intronic
1091094306 11:132804446-132804468 AACTGCTTGTCTTGCTCAGTGGG - Intronic
1093919393 12:24843035-24843057 CCCTGGTTGTATAACTCAGTAGG + Intronic
1096034792 12:48457247-48457269 AACTGCTTGTTGCATTCATTTGG - Intergenic
1096829629 12:54304344-54304366 AGCTGGTTGCATAACTCAGTGGG - Intronic
1098160023 12:67640958-67640980 AAATCCTTCTAGAAGTCAGTGGG + Intergenic
1099246584 12:80199999-80200021 ATGTGCTTATAGAGCTCAGTGGG - Intergenic
1099822245 12:87727407-87727429 ATCTGCTTTCAGTACTCAGTTGG - Intergenic
1101011089 12:100450236-100450258 AACTTCATGTAGATCTGAGTTGG - Intergenic
1103050987 12:117779312-117779334 CACAGCATGTAGAACTCAGCAGG + Intronic
1103227112 12:119297460-119297482 AACTGCCTGTAGCACTTAGCAGG + Intergenic
1103389073 12:120557233-120557255 CACTGCTTGAAGAACTGATTAGG - Intronic
1104811832 12:131624059-131624081 ACCTGCTTGGAGAAGTCAGTCGG - Intergenic
1109278397 13:60327513-60327535 AAGTGTTTGTTGAATTCAGTTGG - Intergenic
1109607432 13:64714668-64714690 AGCTGCTTGGAGGACTCAGGCGG - Intergenic
1111503790 13:89159749-89159771 AACTGTTGGCAGAATTCAGTTGG - Intergenic
1116432469 14:44862736-44862758 TACTCCTTGTAGAACTCTGTCGG + Intergenic
1119166142 14:72495393-72495415 AACTGTAAGTAGAACTCAGCTGG - Intronic
1121566374 14:94913017-94913039 AACTGATAGTATAATTCAGTTGG - Intergenic
1121878727 14:97479789-97479811 AACTGCTTTTTGATGTCAGTAGG + Intergenic
1124124518 15:26927039-26927061 AAGTGCTCCTTGAACTCAGTAGG + Intronic
1124901189 15:33824275-33824297 AACTTCTGTTAGAACTCAGCTGG - Intronic
1125261459 15:37830534-37830556 AACTGCTTTGAGAACTGAGGTGG - Intergenic
1130767197 15:86882641-86882663 AACTCCATGGAGAACTTAGTAGG - Intronic
1130861858 15:87898345-87898367 AACTGCTTCCAGAACTTAGGTGG - Intronic
1133953146 16:10415513-10415535 AACTGCTAGAAGAAATCATTGGG + Intronic
1134140573 16:11714723-11714745 ATTTGCTTGTAGAACTGAGTCGG - Intronic
1134154372 16:11830761-11830783 ACCTGCTTATATAACTCAGCTGG - Intergenic
1135080063 16:19426529-19426551 CACTCCTAGTAGATCTCAGTGGG + Intronic
1135235499 16:20751597-20751619 AAGTGATAGTAGAGCTCAGTGGG + Intronic
1138059724 16:53877534-53877556 AAATGTTGGTAGAAATCAGTTGG + Intronic
1139242135 16:65403937-65403959 ACCTGCTTGTAGTTCTCAGTAGG + Intergenic
1143405888 17:6677022-6677044 AACTGTTTGTGGAACCCAGCAGG + Intergenic
1149354687 17:55827812-55827834 AACCACTTGTAGAAATCGGTGGG + Intronic
1149807758 17:59635452-59635474 AACTGCTGGTTGAAATTAGTAGG + Intronic
1150886748 17:69095480-69095502 AATTTCTTGTAGAAGTCAGTGGG + Intronic
1155907984 18:31475562-31475584 TACTGTTTGTAGAACTCATTTGG - Intronic
1159557022 18:69956152-69956174 AACTGTTTATGGAAATCAGTGGG - Intronic
1161116283 19:2498472-2498494 AAATGCTTGTGGAATTCAGGAGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164743740 19:30595649-30595671 AACTGCTTGGAGAAAGCAGGTGG - Intronic
1165747175 19:38236665-38236687 AACTGCTTGATGAACCCAGGAGG + Intergenic
1166255313 19:41600220-41600242 AACTGTTTATAGGACTCAGCAGG - Intronic
1166563984 19:43752362-43752384 AACTGTTTGTAGAACTCAGTGGG + Intronic
928509923 2:31993696-31993718 AACAATTTCTAGAACTCAGTGGG + Intronic
934275955 2:91573110-91573132 ACCTGCTCCTGGAACTCAGTGGG + Intergenic
937643188 2:124236490-124236512 ACATGCTTGTAGCACTCAGAAGG - Intronic
937748392 2:125443576-125443598 AACTGTTTGTTGAATTCAATGGG + Intergenic
940543931 2:155058594-155058616 AACTCCTTGTAGAGTTCAATAGG - Intergenic
945178056 2:207063561-207063583 AAATGCTGGTAGCACACAGTGGG + Intergenic
946037925 2:216758779-216758801 AAATGTATGTAGAACTCATTTGG + Intergenic
1170199902 20:13731567-13731589 AACTCCTTTTCAAACTCAGTAGG - Intronic
1173438568 20:43055069-43055091 AATTGCTTGTAGTAATTAGTGGG - Intronic
1178186955 21:30233381-30233403 AACTTCTTGTAAAAGTCAGTAGG + Intergenic
1185394496 22:50579726-50579748 ATTTGCTGGTAGAAGTCAGTCGG - Exonic
952422647 3:33145504-33145526 AACTTCCTTTTGAACTCAGTGGG + Exonic
952868503 3:37875146-37875168 AACTGTTTGTAGCACTGGGTTGG + Intronic
958464123 3:94437698-94437720 AATTTATTGTAGAAGTCAGTTGG - Intergenic
959167634 3:102800448-102800470 AAATGCTCGTAGAACTCAAAAGG - Intergenic
963685915 3:148433919-148433941 AAATGCATTTAGCACTCAGTTGG + Intergenic
965841593 3:172911595-172911617 AAATGCCTTTAGAATTCAGTTGG - Intronic
965925664 3:173976386-173976408 AATTGCGTGTAAAACTCATTGGG + Intronic
968196796 3:196713074-196713096 AACTGCTTGTACTACTGAGACGG + Intronic
972670449 4:41209978-41210000 TACTGCTTGTTGATCTGAGTTGG - Intronic
974433379 4:61827341-61827363 TATTGCTTCTAGTACTCAGTAGG + Intronic
974746262 4:66081877-66081899 AACTTCTTGTAGGACTTAATAGG + Intergenic
977304434 4:95304895-95304917 AAATGCTTGAGGAATTCAGTAGG + Intronic
977935258 4:102794922-102794944 AACTGATTCTAATACTCAGTTGG + Intronic
978878477 4:113670979-113671001 AACTGCCTGTAAAAATCATTGGG - Intronic
987423290 5:17746030-17746052 CAGTGCTTGTAGAACACAATCGG - Intergenic
994925955 5:106117652-106117674 AATTGCTTGTATAATTCTGTTGG - Intergenic
995176650 5:109185749-109185771 GACTGCATGTCGAACTCATTTGG + Intronic
997275824 5:132588072-132588094 AACTGCTTGTTGAACAGGGTAGG + Exonic
998667060 5:144309416-144309438 AATTGCTTGTAAAACTCAGGCGG + Intronic
998687379 5:144543905-144543927 AACTCCTTGTGGAAATCAGAAGG + Intergenic
999996705 5:157099205-157099227 AGATGTTTGTAGAACTCATTAGG - Intronic
1002159494 5:177306932-177306954 AAATACTTGTTGAATTCAGTTGG + Exonic
1002506264 5:179681189-179681211 AACTGTTCCTAGAACACAGTAGG - Intronic
1005345623 6:24887085-24887107 AAATGCTTGTAGACAACAGTTGG - Intronic
1006600202 6:35220183-35220205 AAGTGCTTAGAGAACACAGTGGG + Intronic
1008261657 6:49372782-49372804 GACTGCTTTTATAATTCAGTAGG - Intergenic
1009296784 6:61960888-61960910 AACTGCTTCATGCACTCAGTGGG - Intronic
1009376425 6:62976351-62976373 TAGTGCTTGTAGAAATCATTTGG - Intergenic
1010289855 6:74122782-74122804 AGCTGAGTGTAGAACTCAGGTGG - Intergenic
1011132910 6:84070702-84070724 AATTACTTATAGAACTAAGTGGG - Intronic
1011226872 6:85117565-85117587 CACTGATTTTAGAACTCTGTAGG + Intergenic
1011962513 6:93108453-93108475 TGCTGCTTCTAGAACTCACTTGG + Intergenic
1012309412 6:97703207-97703229 AATTGCTTGTATACTTCAGTAGG + Intergenic
1012960736 6:105619219-105619241 TTCTGCTTGTAGAATTCACTTGG - Intergenic
1018255886 6:161918627-161918649 AAATGCTTAACGAACTCAGTGGG + Intronic
1018420342 6:163635323-163635345 ACCTGCATGTACAACTGAGTAGG + Intergenic
1020539553 7:9442908-9442930 TTCTGCTTGTAGGACTCAGGTGG - Intergenic
1027684006 7:81258491-81258513 AACTGATTGTAGAGTTCATTTGG - Intergenic
1028882426 7:95894815-95894837 AGATGCTTGAAGAAGTCAGTTGG + Intronic
1033319348 7:140325881-140325903 AACTGAGTTTAGAGCTCAGTCGG - Intronic
1033836481 7:145319147-145319169 ATCTGCTTTTACAATTCAGTTGG + Intergenic
1037026722 8:14047507-14047529 AACTGCTGGGAGAATTCAGTGGG - Intergenic
1037163711 8:15801440-15801462 AACTGTTTGGAGAATTCATTGGG + Intergenic
1042702893 8:71636349-71636371 AAATGCTTGGAAAACTCAGCTGG - Intergenic
1043526911 8:81107112-81107134 AACTGGTAGTAGAGCACAGTGGG - Intronic
1047825821 8:128573661-128573683 AACTGTGTAGAGAACTCAGTTGG + Intergenic
1051013195 9:12444203-12444225 AACTACTTCCAGAGCTCAGTGGG + Intergenic
1052104855 9:24500679-24500701 AACTGCTTATTGAAATCAGAGGG + Intergenic
1053544418 9:39008596-39008618 AATTGATGGAAGAACTCAGTGGG - Intergenic
1053780188 9:41599286-41599308 AACAGCTTGGAGCACTCAGAAGG + Intergenic
1053843053 9:42206649-42206671 AAATGCATGCATAACTCAGTTGG - Intergenic
1054168130 9:61809443-61809465 AACAGCTTGGAGCACTCAGAAGG + Intergenic
1054669400 9:67771375-67771397 AACAGCTTGGAGCACTCAGAAGG - Intergenic
1057225417 9:93290467-93290489 GGCTCCTTCTAGAACTCAGTAGG - Intronic
1058149391 9:101447267-101447289 AACTGTGTGTAAAACTCATTTGG - Intergenic
1060289600 9:122289118-122289140 AAATACATGTAGAATTCAGTAGG + Intronic
1060572462 9:124655038-124655060 AACTAATTGCTGAACTCAGTTGG - Intronic
1062068607 9:134542463-134542485 AAGAGCTTGTACAAATCAGTGGG - Intergenic
1188791447 X:34412437-34412459 AGGTGTTTGTAGAACTCAGACGG - Intergenic
1188919487 X:35954985-35955007 AACAGCTTAAAGAACTCACTTGG - Intronic
1191697212 X:64002572-64002594 AACTGTTTGCAGAACTCAGCAGG - Intergenic
1196216405 X:113057368-113057390 GACTCTTTGTAGAACTCATTAGG + Intergenic
1196697619 X:118630381-118630403 TACTCCTTGTAGAACTCTGTCGG - Exonic