ID: 1078266406

View in Genome Browser
Species Human (GRCh38)
Location 11:9758757-9758779
Sequence TCGTGACCACGGATGCCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078266406_1078266408 -7 Left 1078266406 11:9758757-9758779 CCTTGCGGCATCCGTGGTCACGA No data
Right 1078266408 11:9758773-9758795 GTCACGATTCCAGCCCCACACGG No data
1078266406_1078266418 27 Left 1078266406 11:9758757-9758779 CCTTGCGGCATCCGTGGTCACGA No data
Right 1078266418 11:9758807-9758829 TCCCTGCGAGTGCCCAAGACGGG No data
1078266406_1078266417 26 Left 1078266406 11:9758757-9758779 CCTTGCGGCATCCGTGGTCACGA No data
Right 1078266417 11:9758806-9758828 GTCCCTGCGAGTGCCCAAGACGG No data
1078266406_1078266420 28 Left 1078266406 11:9758757-9758779 CCTTGCGGCATCCGTGGTCACGA No data
Right 1078266420 11:9758808-9758830 CCCTGCGAGTGCCCAAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078266406 Original CRISPR TCGTGACCACGGATGCCGCA AGG (reversed) Intergenic
No off target data available for this crispr