ID: 1078269374

View in Genome Browser
Species Human (GRCh38)
Location 11:9780773-9780795
Sequence TCGTCTTTGACTAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078269371_1078269374 0 Left 1078269371 11:9780750-9780772 CCTTATTTTGCATTTTCTTAGTG 0: 1
1: 2
2: 4
3: 55
4: 575
Right 1078269374 11:9780773-9780795 TCGTCTTTGACTAAGGAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078269374 Original CRISPR TCGTCTTTGACTAAGGAGGA AGG Intronic
903095801 1:20972142-20972164 TTGTCTTTGTCTAATGAGGCAGG - Intronic
912395088 1:109336303-109336325 TCACTTTTGACCAAGGAGGAAGG - Exonic
912407164 1:109449794-109449816 TAATCTTTGACAAAGGAGCAAGG + Intergenic
920535515 1:206734146-206734168 TCGTCTTTGTGTATGGGGGAAGG + Exonic
921138919 1:212286447-212286469 ACCTGTTTGAATAAGGAGGAGGG - Intronic
921605522 1:217149310-217149332 TCATCTTTGAAAAAGGAGCAAGG + Intergenic
922866063 1:228862653-228862675 TCTTCTTAGAAAAAGGAGGAGGG - Intergenic
1064842173 10:19605528-19605550 TCGCTTTTGACTAGGGAGGTTGG - Intronic
1072447600 10:95513140-95513162 TCACCTTTGCCTAAGCAGGAGGG + Intronic
1072870200 10:99111092-99111114 TGATCTTTGACAAAGGAGGAAGG - Intronic
1078269374 11:9780773-9780795 TCGTCTTTGACTAAGGAGGAAGG + Intronic
1088523108 11:110720666-110720688 TGTTCGTGGACTAAGGAGGAGGG - Intergenic
1091985617 12:4908798-4908820 TTGGCTTTGATTAAGGAGGTGGG + Intergenic
1096024452 12:48349537-48349559 TTGTCTTTGACAAAAGAGGTAGG + Intronic
1098792897 12:74848368-74848390 TCCTCTGTGACTAAGGAGACAGG + Intergenic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1102512027 12:113422334-113422356 TTCTCTTTAACAAAGGAGGAGGG + Exonic
1102994105 12:117335033-117335055 TCGTCTCTGAGTAACGGGGAGGG + Intronic
1104236542 12:126943886-126943908 AGCTCTTTGACTAAGAAGGACGG + Intergenic
1104309195 12:127638651-127638673 ACGTCTTTGACAAAGGAGTTTGG + Intergenic
1106227107 13:27793901-27793923 TCGTCCTTCCCTGAGGAGGACGG - Exonic
1109753586 13:66728343-66728365 TAGTTTTTGACTAATTAGGAAGG + Intronic
1110574449 13:77039772-77039794 TCGGCTTTGAAGATGGAGGAAGG - Intergenic
1118066304 14:62194694-62194716 TAATCTTTGACAAAGGAGCAAGG - Intergenic
1119008493 14:70957601-70957623 TTGTCTAGGGCTAAGGAGGATGG + Intronic
1121500514 14:94432513-94432535 TGATCTTTGACAAAGGAGCAAGG - Intergenic
1121727571 14:96164443-96164465 TTGTCTTTGAGGATGGAGGAGGG + Intergenic
1125536989 15:40446782-40446804 CTGTCTTTGGGTAAGGAGGATGG + Intronic
1127180813 15:56415402-56415424 TGGTCTTTGTATAAGGTGGAAGG + Intronic
1134248693 16:12559080-12559102 TCATCCTAGACTAAGGAGCACGG - Intronic
1142031575 16:87841049-87841071 GCCTCTTTGCCTATGGAGGATGG - Exonic
1143374788 17:6461179-6461201 TCGTCGTTGACAGAGGAGAAAGG - Intronic
1143813131 17:9488607-9488629 TTGTCTTTGAAGACGGAGGAAGG + Intronic
1146352239 17:32104468-32104490 TCATCTTTGACAAAGGATCAGGG - Intergenic
1151481924 17:74374707-74374729 TATTCTTTGCTTAAGGAGGAGGG + Intergenic
1155608681 18:27637385-27637407 TTGTTTTTGAATAAGAAGGAGGG - Intergenic
1156493025 18:37507594-37507616 TGAGATTTGACTAAGGAGGATGG - Intronic
1156592173 18:38503046-38503068 TCATATTTGACTAAAGAGGTGGG + Intergenic
1157928230 18:51789862-51789884 TCATCTTTTACTAATGAGGAAGG + Intergenic
1158580749 18:58680524-58680546 TCATCTTTGAAGAAGGAGTAAGG + Intronic
1159304577 18:66624057-66624079 TCCTCTTTCTCTAAAGAGGAAGG + Intergenic
1162300660 19:9843064-9843086 GTGTCCTTGTCTAAGGAGGATGG + Intronic
1168190076 19:54731752-54731774 TGGGCTTTGAGGAAGGAGGAAGG - Intronic
1168192311 19:54748140-54748162 TGGGCTTTGAGGAAGGAGGAAGG - Intronic
1168196636 19:54779417-54779439 TGGGCTTTGAGGAAGGAGGAAGG - Intronic
1168202415 19:54825832-54825854 TGGGCTTTGAGGAAGGAGGAAGG - Intronic
1168207218 19:54859884-54859906 TGGGCTTTGAGGAAGGAGGAAGG - Intronic
1168438135 19:56338663-56338685 GGGTCTTTGTCTAGGGAGGAAGG + Intronic
926544776 2:14226072-14226094 TTGGCTTTGAATATGGAGGAAGG - Intergenic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
931983562 2:67720209-67720231 TCTTCTTTCACTCAGTAGGAGGG - Intergenic
933095624 2:78175505-78175527 TTTTCTTTCACTAATGAGGAAGG - Intergenic
944456328 2:199898566-199898588 TAATCTTTGACAAAGGAGCAAGG + Intergenic
944879515 2:203997785-203997807 TTGGATTTTACTAAGGAGGAAGG - Intergenic
947204137 2:227644769-227644791 TCATCTTTAGATAAGGAGGAAGG + Intergenic
947393487 2:229664243-229664265 TCTTCTTTGACCAATGAGGTTGG - Intronic
947603653 2:231469657-231469679 TCTTCTTTGAGAAAGGAAGAAGG - Intronic
1168993726 20:2116651-2116673 TCTTCTTTGATTTAGGAGAAAGG + Exonic
1171467939 20:25344855-25344877 TCATCTGTGACAAAGGAGCAAGG + Intronic
1172482366 20:35278315-35278337 CATTCTTTGACTAAGGTGGATGG - Intergenic
1172621862 20:36322724-36322746 TAGTCACTGACTCAGGAGGATGG - Intronic
1179061010 21:37979486-37979508 AGGTCCTTGACTAGGGAGGAGGG + Intronic
1182664652 22:31948769-31948791 TCGTCTTTGAGGAAGGAAGAAGG + Intronic
1183362890 22:37391859-37391881 TCCTCTGAGACTCAGGAGGAAGG + Intronic
1185161015 22:49229944-49229966 GCATCTTTGAGTGAGGAGGATGG + Intergenic
950444637 3:13029527-13029549 TCTTCTTTGTCTAAGGAAGGGGG - Intronic
951343439 3:21516906-21516928 TCTTCTTTCCCCAAGGAGGATGG - Intronic
963935426 3:151047310-151047332 TCATCTTTGAGTTAGGAAGATGG + Intergenic
964716816 3:159731640-159731662 TTGTCTTGGAGTCAGGAGGAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968870752 4:3240929-3240951 TCGTCTGTGCCCGAGGAGGAGGG - Exonic
970340737 4:15103912-15103934 TTGTTTTTGATTAAGGAGGAAGG + Intergenic
972867658 4:43254698-43254720 ACATCTTTGACTAATGACGAAGG + Intergenic
976801755 4:89000494-89000516 TGGTCTTTGCCTAAGGATGTGGG + Intronic
979660776 4:123252490-123252512 TCTTCTTTGACTAAGCAGTTTGG - Intronic
987448886 5:18056543-18056565 ACTTCTTTGACTAAGGAGAAAGG + Intergenic
995832568 5:116370162-116370184 TCCTGTTTGACTAAGCTGGAAGG + Intronic
996530607 5:124523078-124523100 TGGTCTTTGGCTGAAGAGGAAGG - Intergenic
996578709 5:125006103-125006125 TGGTCTTTGGCTAATAAGGAAGG + Intergenic
998400083 5:141844162-141844184 TCACGGTTGACTAAGGAGGAAGG - Intergenic
999446671 5:151645914-151645936 TAGGCTTTGACTAAGGAGAGAGG + Intergenic
1005741153 6:28791840-28791862 TCATCTTTTCTTAAGGAGGATGG - Intergenic
1007668803 6:43534526-43534548 TAGGCTTTGAGTAAGGAGCAAGG + Intronic
1012293402 6:97488277-97488299 TCATCTTTGACAAATGAGCAAGG - Intergenic
1021757359 7:23865866-23865888 TCCTCTTTTACATAGGAGGAAGG + Intergenic
1022170213 7:27820218-27820240 TCGTCTTTGATAGAGGAGAAAGG - Intronic
1027432706 7:78131122-78131144 TCATCTTAGACTCAAGAGGAAGG - Intronic
1030862221 7:114648176-114648198 TTGTCTTTGACTAGGCAGCATGG + Intronic
1033436795 7:141340126-141340148 TTGGCTTTGAATATGGAGGAAGG + Intronic
1036513195 8:9419642-9419664 TCGCATTTGACTAATGAGTACGG + Intergenic
1037318975 8:17626415-17626437 TCGTCTTAGAGTCAGGAGGAAGG + Intronic
1037471540 8:19215840-19215862 TGGTCATTTACAAAGGAGGATGG + Intergenic
1039318814 8:36405306-36405328 TCATCTTGGACCCAGGAGGAAGG - Intergenic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1043014726 8:74923700-74923722 TATTCTTTGACTAAGTAGTATGG + Intergenic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG + Intergenic
1055054153 9:72008219-72008241 TCCTCTTTGTCTAACGAAGAGGG - Intergenic
1055852323 9:80646571-80646593 TTTTCATTGACTAAAGAGGAGGG - Intergenic
1058569409 9:106324596-106324618 AAGTCTATGACTTAGGAGGAGGG + Intergenic
1060743548 9:126114774-126114796 TTCTCTGTGACGAAGGAGGAAGG - Intergenic
1192531276 X:71888850-71888872 TTGGCTTTGAAGAAGGAGGAAGG + Intergenic
1195369840 X:104162637-104162659 TGATCTTTGACAAAGGAGCAAGG + Intergenic
1201480275 Y:14431414-14431436 TGGTCTTTGACAAAACAGGAAGG - Intergenic