ID: 1078270028

View in Genome Browser
Species Human (GRCh38)
Location 11:9786753-9786775
Sequence GTGGATTAAATAGGATACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078270024_1078270028 -10 Left 1078270024 11:9786740-9786762 CCATTCCCTCACAGTGGATTAAA 0: 1
1: 0
2: 0
3: 13
4: 202
Right 1078270028 11:9786753-9786775 GTGGATTAAATAGGATACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
1078270020_1078270028 17 Left 1078270020 11:9786713-9786735 CCTGTTCCTTGTGTAGGAGAGGG 0: 1
1: 0
2: 1
3: 22
4: 368
Right 1078270028 11:9786753-9786775 GTGGATTAAATAGGATACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
1078270022_1078270028 11 Left 1078270022 11:9786719-9786741 CCTTGTGTAGGAGAGGGAACGCC 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1078270028 11:9786753-9786775 GTGGATTAAATAGGATACGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078270028 Original CRISPR GTGGATTAAATAGGATACGA AGG Intronic
913561247 1:120022545-120022567 GTGGATGAAATAGAAGAAGAGGG - Intronic
913636880 1:120771057-120771079 GTGGATGAAATAGAAGAAGAGGG + Intergenic
914281833 1:146181955-146181977 GTGGATGAAATAGAAGAAGAGGG - Intronic
914542877 1:148632893-148632915 GTGGATGAAATAGAAGAAGAGGG - Intronic
914623759 1:149438350-149438372 GTGGATGAAATAGAAGAAGAGGG + Intergenic
914868526 1:151453525-151453547 GTGGATTATGTAGGCTACCAAGG + Intronic
919694716 1:200562736-200562758 GTGGATGAAATAGTAGATGAAGG - Intronic
921403166 1:214749070-214749092 GTGGATTCAATATTATACCATGG - Intergenic
924331317 1:242943521-242943543 GGGAATTAAAGAGGATATGATGG - Intergenic
1069680547 10:70282220-70282242 GTGGAATAAAGAGGATAAGGAGG - Intronic
1078270028 11:9786753-9786775 GTGGATTAAATAGGATACGAAGG + Intronic
1080921612 11:36714750-36714772 ATGGATTTATTAAGATACGAGGG - Intergenic
1087880242 11:103407232-103407254 GTGGATTAATTAGTACAGGAAGG + Intronic
1093688342 12:22082087-22082109 GTGGAATAGATTGGATTCGAAGG - Intronic
1097862160 12:64528621-64528643 ATGTATTAAATAGGCTACAAAGG + Intergenic
1100079160 12:90826615-90826637 CTGGATTAAATAGGATCTTATGG - Intergenic
1101050227 12:100855224-100855246 GGGGAGAAAAAAGGATACGATGG - Intronic
1101598189 12:106185933-106185955 GTGGATTAAATGAGATAATATGG - Intergenic
1102858144 12:116312589-116312611 GAGGATTAAATAAGATAACAGGG + Intergenic
1103013040 12:117472392-117472414 GTGGATGAAACAGGATGCTAGGG + Intronic
1110372470 13:74755296-74755318 GATGATTAAATAAGATACTATGG - Intergenic
1110544257 13:76738551-76738573 ATGGCTTAAACAGGATACAATGG - Intergenic
1110958519 13:81589351-81589373 TTGGATAAAATAGGATATAAAGG - Intergenic
1113183933 13:107664471-107664493 TTGCATTAAATAGGAAACAATGG - Intronic
1118187874 14:63554000-63554022 GAGGATTAAACAAGATACTATGG - Intergenic
1119342533 14:73891744-73891766 GTTTATTACATAGGATAAGACGG + Intronic
1120756444 14:88248925-88248947 GAGGACTAAATAGGATAATAAGG - Intronic
1120911209 14:89668748-89668770 GTGGAATGAATAGGGTAGGATGG - Intergenic
1121379346 14:93449098-93449120 GTGGACTAAATATGAAAGGATGG - Intronic
1123156064 14:106227045-106227067 GAGGATAAAATGGGATACAAAGG + Intergenic
1131074631 15:89487253-89487275 GTGGTTTAAATAGGCTAAGGTGG - Intronic
1134205119 16:12231205-12231227 GTTGATTAAATAGGATGTAAAGG + Intronic
1139570366 16:67807778-67807800 GAGGATTAAATATGGTACGTAGG - Intronic
1143917185 17:10302710-10302732 GTGGATGAAAAAGGATGGGATGG + Intronic
1144538854 17:16119032-16119054 TTGTATTTAATAGGATAGGATGG - Intronic
1147021357 17:37536457-37536479 GAGGATTAAATAGGGTAATATGG + Intronic
1147387991 17:40092869-40092891 GTGGTTTAAATAGGGGAGGAGGG + Exonic
1155263294 18:24066428-24066450 GTAATTCAAATAGGATACGATGG + Intronic
926598442 2:14815695-14815717 CTGGATTGAATAGAATAGGAAGG - Intergenic
926650147 2:15334748-15334770 GTTGTTTAAAGAGGATACCATGG - Intronic
927017974 2:18987076-18987098 GAGGATTACATAGGATACAATGG - Intergenic
930994860 2:57704221-57704243 GTGGCTTGAATAGGTTAAGATGG + Intergenic
943570916 2:189574114-189574136 GTTGATTATATAGGATAAGTGGG + Intronic
945478168 2:210311060-210311082 GAGGATTAAATAAGATAACATGG + Intronic
945973188 2:216250533-216250555 CTGGATTAAATAAGCTACCATGG - Intergenic
1169866044 20:10201264-10201286 GAAGATTAAATAGAATAAGAAGG - Intergenic
1169953003 20:11068031-11068053 ATGGATTCAATAGGCTACAAAGG + Intergenic
1170937544 20:20823189-20823211 GTGGATCAAATATTATAAGATGG + Intergenic
1184391001 22:44203428-44203450 TTGGATTAAATAAAATACTATGG - Intronic
949824989 3:8155986-8156008 GAGGATTAAATAAGATAACATGG + Intergenic
957631307 3:82719337-82719359 GTGGCTTACATGGGCTACGAGGG + Intergenic
958255362 3:91319412-91319434 GTTGATTAAATAGGCTACTGAGG + Intergenic
958931866 3:100215992-100216014 GTGGATTAAAAAGGACACAAAGG - Intergenic
962085141 3:132183247-132183269 GTGTAATAAAGAGGATTCGATGG + Intronic
963459075 3:145584387-145584409 GTGTATTAAATAGAATTCAAAGG + Intergenic
966695104 3:182781469-182781491 GTGGATTAAATTGTATACAGTGG + Intergenic
970947292 4:21709988-21710010 TTAGATTAAATTGGATAGGAGGG + Intronic
970982051 4:22110254-22110276 ATGGATTAAATTGGATTGGATGG - Intergenic
973828607 4:54735637-54735659 GTGGGTTAAATAAGATAAAATGG - Intronic
975113602 4:70653848-70653870 GTGGAGCAAAGAGGATAGGAAGG + Intronic
975192517 4:71481689-71481711 TTGGAATAAATAGGCTAAGAAGG + Intronic
976157804 4:82166648-82166670 GTGAATTAAATAAGATATGATGG + Intergenic
976823775 4:89236409-89236431 GTTTATTAAATAGAATACAATGG + Exonic
979912486 4:126385873-126385895 GTGGATTAAAAAGTAGAAGATGG + Intergenic
980344102 4:131590224-131590246 GTGGCTTTAATAGGAGACCATGG + Intergenic
981687766 4:147474176-147474198 GTCAATTAAATATGATACAATGG + Intergenic
984624280 4:181988132-181988154 GTAGATGAAATAAGATAGGAAGG - Intergenic
990016846 5:51073565-51073587 ATGCATTGAATAGGATAAGAAGG - Intergenic
990593053 5:57284692-57284714 GTGAATTAAATAAGTTACCAGGG + Intergenic
992146052 5:73849744-73849766 GTGGCTTAGAGAGGATACAAGGG - Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993775793 5:91993984-91994006 GTGGATTAAATATGATTTCAAGG + Intergenic
996761782 5:126993271-126993293 ATGGTTGAAATAGGAGACGATGG - Intronic
998932087 5:147192442-147192464 GTAGATTAAATAGGAGAATAGGG + Intergenic
999572975 5:152941574-152941596 GTAGATAAAATAGGATGCCAAGG - Intergenic
1000828315 5:166073608-166073630 GAGGATTAAATAGGATAGTATGG + Intergenic
1000989461 5:167897114-167897136 GTGGATTAATCAGGAAGCGAGGG - Intronic
1004620650 6:17327479-17327501 TTGAATTAAATAGGATTGGATGG + Intergenic
1009661454 6:66617374-66617396 GAGGATTAAAATGGATACCAAGG + Intergenic
1012952071 6:105528947-105528969 GTGGATTAAATAGTTTACCTAGG + Intergenic
1016571093 6:145513848-145513870 CTGGATTAATTAGAATAGGATGG + Intronic
1017428975 6:154351788-154351810 GTGGCTTAAATAGCATAAAAAGG + Intronic
1038206442 8:25471075-25471097 GTGCTTTAAATAGGTTAAGAGGG + Intronic
1038574197 8:28690061-28690083 GTGGCTGAAATAGGATAAAAGGG + Intronic
1040893983 8:52346769-52346791 GTGGATTCAAGAGGATAGAAAGG + Intronic
1042165415 8:65940996-65941018 CTGGATTAAAGAGGATACCATGG + Intergenic
1043240802 8:77932623-77932645 GAGGATTGAAGTGGATACGAAGG - Intergenic
1044055517 8:87565413-87565435 GTGGTTTTAATAGGATAGCAGGG - Intronic
1046264906 8:111817894-111817916 GTGGATTGCATAGGACAGGAGGG + Intergenic
1051792477 9:20822419-20822441 GTGGATTAGAAAGGAGAGGAAGG + Intronic
1052605605 9:30695382-30695404 TTGGATTAAATTGGATGCAATGG - Intergenic
1056023507 9:82466427-82466449 GTGGACTAAATTAGATAGGATGG - Intergenic
1186245994 X:7617607-7617629 GTGATTTGAATAGGATATGATGG + Intergenic
1193183088 X:78481702-78481724 GTAGATTGAATAGGATATAAAGG + Intergenic
1195664037 X:107412527-107412549 GTTGGTTAAATAGGATACTTTGG + Intergenic
1197986322 X:132269728-132269750 GTGGATAAAATAGGTCAGGAGGG - Intergenic
1199430266 X:147751660-147751682 GTGGATTAAATATGATATTAGGG - Intergenic
1201062108 Y:10055463-10055485 ATTGATTAAATAGGGTATGATGG - Intergenic
1201543516 Y:15134839-15134861 GAGAATTAAAAAGGATACCAAGG + Intergenic