ID: 1078275810

View in Genome Browser
Species Human (GRCh38)
Location 11:9844979-9845001
Sequence GTGATGTACTTAAGGATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078275810 Original CRISPR GTGATGTACTTAAGGATAAA GGG Intronic
900858412 1:5205009-5205031 GAGATCTACTTGAGGATACAGGG + Intergenic
905751287 1:40466859-40466881 CTGATATACTTTAAGATAAAAGG + Intergenic
906819628 1:48915747-48915769 CTGCTGTACTAAAGGATAGAAGG + Intronic
909132902 1:71761419-71761441 GAGATTTACTTCAGGATAAACGG - Intronic
910162277 1:84286364-84286386 TTGATTTGCTTAAGAATAAAGGG - Intergenic
910681834 1:89874107-89874129 GTGAGGCACTTAACGATTAAAGG + Intronic
911443962 1:97967673-97967695 GAAATGTAATTAAAGATAAAGGG - Intergenic
911521058 1:98931440-98931462 TCGATGGACTTAAGGCTAAAAGG + Intronic
914881397 1:151549662-151549684 GTGATTTGCTCAAGGATTAATGG + Intronic
916213608 1:162377767-162377789 TTGAAGTACTTAGGTATAAAAGG - Intronic
918211915 1:182358678-182358700 GTGATGGAGTCAAGGAAAAAAGG + Intergenic
918640981 1:186841014-186841036 GTGATGTACTTACTGTTAACAGG - Intronic
918890623 1:190262458-190262480 GTGCTGTAACTAAGGAAAAAAGG - Intronic
919603954 1:199657102-199657124 ATGGTGTTCTTAAAGATAAAAGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
924461518 1:244263692-244263714 GTGAAGTACTTAGGGGTAAAAGG + Intergenic
1062839114 10:656933-656955 GTGAGGAACTCAAGGAGAAATGG + Intronic
1063195904 10:3742612-3742634 GTTATGTAATCAAGGTTAAATGG - Intergenic
1063456693 10:6188174-6188196 CTGAAGTACTTAGGGACAAAAGG - Intronic
1069244037 10:66179580-66179602 TAGATCTACTTAAAGATAAATGG + Intronic
1071596577 10:86932224-86932246 CTGAAGTATTTAGGGATAAAGGG - Exonic
1072904182 10:99435889-99435911 GTGATCCATTTAAGGAGAAACGG - Intergenic
1076489673 10:130849675-130849697 GTGAAGTGTTTAGGGATAAAAGG - Intergenic
1077858420 11:6152434-6152456 GTGATGTACATAAGGTAGAAAGG + Intergenic
1078275810 11:9844979-9845001 GTGATGTACTTAAGGATAAAGGG + Intronic
1086909213 11:92452631-92452653 GTGATTCAGTTAATGATAAATGG + Intronic
1087672568 11:101126182-101126204 GTGGTGCACTTAAAAATAAATGG - Intronic
1090035853 11:123248946-123248968 GTGATTTACAAAAGGATAGATGG + Intergenic
1090190815 11:124766241-124766263 TTGATGTACTTAGGGTCAAAAGG + Intergenic
1090521034 11:127479645-127479667 GTGGTTTACTTAAAGAAAAAAGG - Intergenic
1090834802 11:130446617-130446639 GTGATGATTTTAAGCATAAAGGG - Intergenic
1091251147 11:134145401-134145423 CTGAAGTATTTATGGATAAAAGG + Intronic
1092520714 12:9269834-9269856 GTGATGTATTAAAAAATAAAAGG - Intergenic
1093081443 12:14816313-14816335 GGGATGAGCTTTAGGATAAAAGG - Intronic
1097404265 12:59170087-59170109 GAGAGGTACTGAAGAATAAAAGG - Intergenic
1097966586 12:65588032-65588054 GTGCTGTACTTAAGGAAATCTGG - Intergenic
1098115205 12:67168539-67168561 TTGATGTACTCAAGAAAAAATGG + Intergenic
1098120690 12:67234655-67234677 GGGGTCTACTTAAGGGTAAAGGG - Intergenic
1099775203 12:87118428-87118450 GAAATTTACTCAAGGATAAATGG - Intergenic
1100762934 12:97829840-97829862 GTGATGGGAATAAGGATAAAGGG - Intergenic
1100794416 12:98165083-98165105 TGGATGTAATTAAGGTTAAATGG + Intergenic
1101114597 12:101519646-101519668 AGGATGTAATTAAGGTTAAAAGG - Intergenic
1101414495 12:104497548-104497570 GTGAGGTACTTAAGCATCAGAGG - Intronic
1102196745 12:111031317-111031339 CTGAAGTATTTAGGGATAAAGGG - Intergenic
1104526480 12:129528215-129528237 GTGTTTTTCTTAAGGATAATTGG - Intronic
1105735814 13:23269116-23269138 GAGATGTACTTTTGGAAAAAAGG + Intronic
1105818302 13:24057189-24057211 GAGATATACTTAATGTTAAATGG - Intronic
1106087883 13:26558664-26558686 GTGATGGGCTTAGGGATCAATGG + Intronic
1106995696 13:35477735-35477757 GTGATTTAATTAAGGGAAAATGG + Intronic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1110171710 13:72508714-72508736 GTGATGTAGTTAGGGTTAGAAGG + Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1111536915 13:89613525-89613547 GTAATATAATTAAGAATAAATGG - Intergenic
1111893020 13:94106755-94106777 GTGAAGTAGTAAAGTATAAATGG + Intronic
1111968189 13:94882216-94882238 GTCATGTTCTAAAGGAGAAAAGG - Intergenic
1113139882 13:107135442-107135464 GTGATGTTATTAAGGACAGAAGG - Intergenic
1113265733 13:108615966-108615988 GTGTTCTACTTCAGGATATAAGG - Intronic
1113612818 13:111659779-111659801 GTGGCTTACTTTAGGATAAAGGG + Intronic
1113715691 13:112505205-112505227 GTGATCTCCTAAAGGATAAAAGG - Intronic
1117584469 14:57186183-57186205 GTGATCTACTTTAGTAGAAATGG - Intergenic
1118531758 14:66714115-66714137 GGGATGTATTTAATCATAAAGGG + Intronic
1118915830 14:70103886-70103908 GACATGGACTTAAGTATAAAGGG + Intronic
1119609821 14:76052338-76052360 GTTATGTGCTGAAGGGTAAAAGG - Intronic
1123886568 15:24733036-24733058 GGGATGTACTTAAGATTAATAGG - Intergenic
1124886642 15:33693489-33693511 GTGATGAAATTAAGGAGGAAAGG + Intronic
1126246102 15:46508020-46508042 GTGAAGAACTTACAGATAAAAGG + Intergenic
1127707712 15:61563557-61563579 GTGATGTACTTAAGAATAGATGG - Intergenic
1129073208 15:72969282-72969304 GTGAAATATTTAAGGATGAAGGG - Intergenic
1130724630 15:86426276-86426298 ATGATGTACAAAAGGATTAAAGG + Intronic
1134909648 16:18013201-18013223 GAGATGTACTTAAGCACATATGG + Intergenic
1140886480 16:79248897-79248919 ATTATGTACTTAATGATAAATGG - Intergenic
1145895241 17:28453628-28453650 GTGATATTCTTTAGAATAAATGG - Intergenic
1146003162 17:29143715-29143737 GTGTTGTACTTAAGGAAGCAGGG - Intronic
1148657100 17:49293833-49293855 GAGAAGTACTTAATGAAAAAAGG - Intronic
1149722235 17:58857123-58857145 GTGAAGTATTTAGGGATAACAGG - Intronic
1154069575 18:11141276-11141298 GTGGTGTATTTAAGGAAGAATGG + Intronic
1155275094 18:24179472-24179494 ATGATCTACATAAGGAAAAAAGG + Intronic
1155677985 18:28453285-28453307 CTGATGGACTTAAAGATCAATGG - Intergenic
1156057910 18:33032986-33033008 GTGAAGTACTTAAGGCAGAAAGG - Intronic
1156660213 18:39337677-39337699 GGGATGTACTTAAGGAAGAATGG - Intergenic
1157145305 18:45156592-45156614 GTAACTTACTTAAGGATACATGG - Intergenic
1160927712 19:1555055-1555077 TTGATGTACAAAAGCATAAATGG + Exonic
1166023889 19:40061060-40061082 GAGATTTATTTAATGATAAAAGG + Intergenic
925306934 2:2854451-2854473 CTGATGTACTGAAGGAACAAAGG + Intergenic
925444623 2:3916901-3916923 GGGAGGTACTGAAGGGTAAATGG - Intergenic
925519666 2:4729562-4729584 GTGATCCACATAAGTATAAAAGG + Intergenic
925659079 2:6183578-6183600 CTGAAGTCCTGAAGGATAAAGGG - Intergenic
926593732 2:14767426-14767448 TTGAAGTACTGGAGGATAAAGGG - Intergenic
926615997 2:14997140-14997162 GGGATGTACTTGAGGATGGAGGG + Intergenic
927726181 2:25425052-25425074 GGGATGTACTTAAACATACATGG - Intronic
928025314 2:27734918-27734940 CTGAAGTATTTAGGGATAAAGGG - Intergenic
928156411 2:28881011-28881033 CTGAAGTATTTAGGGATAAAGGG - Intergenic
929584170 2:43103029-43103051 CTGAAGTATTTAAGGGTAAAGGG + Intergenic
930072177 2:47375614-47375636 CTGAAGTACTTAGGGGTAAAGGG - Intronic
930569574 2:53067948-53067970 GTCTTGTACTTAAGCATGAACGG + Intergenic
930829129 2:55724623-55724645 GTGATGAAATTAAGGAAACATGG + Intergenic
931207741 2:60164312-60164334 GTGATGTATGTAAGTACAAATGG - Intergenic
931554762 2:63490244-63490266 ATGATGTACTTCAGTCTAAATGG - Intronic
933509011 2:83215672-83215694 GTGATCTAATTATGAATAAAGGG - Intergenic
934095493 2:88598842-88598864 CTGATGTATTTAAGAGTAAAGGG + Intronic
935153422 2:100460719-100460741 TTGAGGAACTTAAGGAAAAATGG + Intergenic
938031258 2:127996051-127996073 TGGAGGTACTTACGGATAAATGG + Intronic
938421523 2:131151184-131151206 GTAATGTAATAAAGGACAAATGG - Intronic
940079982 2:149790019-149790041 TTGACGCATTTAAGGATAAATGG - Intergenic
940355231 2:152734177-152734199 ATAATGGACTTAAGGAAAAACGG - Intronic
940467302 2:154047418-154047440 GTGATGTAGTTAAGAGTATATGG + Intronic
941090702 2:161171584-161171606 GTAATGTTCTCAAGGCTAAATGG + Intronic
941632396 2:167899002-167899024 GTGAAGAACTTAATGAGAAATGG - Intergenic
943469018 2:188269093-188269115 GTGATGTACAAAAGGATTTAAGG + Intergenic
944278325 2:197865452-197865474 GTGAGCTCCTTAAGGTTAAAGGG - Intronic
944626669 2:201576687-201576709 GGGAGGTACTTAAGGAGAACTGG + Intronic
945454544 2:210034995-210035017 TTGATGTATTTAGGGCTAAAGGG - Intronic
945513921 2:210738431-210738453 TTGAAGTATTTAAGGATAAAGGG - Intergenic
948964349 2:241365117-241365139 TTGATGTACATAAGGATTCAAGG - Intronic
1171227082 20:23451008-23451030 GGGATGGACTGAAGGATAAATGG - Intronic
1173060953 20:39660688-39660710 ATGAAGTAATTAAGGTTAAATGG - Intergenic
1173528898 20:43753391-43753413 GTAATGTATTTAAGAATATAAGG + Intergenic
1174029083 20:47606552-47606574 GAAAGGTACTTAAGGAAAAAAGG - Intronic
1174283993 20:49459443-49459465 TTGAGTTACTTAAGGAGAAAAGG + Intronic
1174892535 20:54412233-54412255 GTGATGTATTAAATGATACAGGG - Intergenic
1182513151 22:30834014-30834036 GGGATGTATGGAAGGATAAATGG - Intronic
1182874716 22:33681410-33681432 GTCATGAACCTAAGGATACAGGG - Intronic
949420596 3:3861561-3861583 TTGAGGTATTTAACGATAAATGG - Intronic
951379440 3:21965777-21965799 CTGAAGTATTTAGGGATAAAAGG + Intronic
952245074 3:31579162-31579184 ATAAAGTACTTAGGGATAAAAGG - Intronic
952285765 3:31968144-31968166 CTGAAGTATTTAAGGGTAAAGGG - Intronic
952411888 3:33056765-33056787 CTGATGTATTTAGGGATAAAGGG - Intronic
952621053 3:35342979-35343001 GTGATGTATTTGGGGAGAAATGG - Intergenic
952750814 3:36823430-36823452 GTGATGAACTGAAGGAGAGAGGG + Intergenic
953056726 3:39393406-39393428 CTGAGGTACTTAAAGTTAAAAGG - Intronic
956389274 3:68754120-68754142 GTGAAGTAGTTAGGGGTAAAGGG - Intronic
956417329 3:69046247-69046269 GTGATAAACTTGAGTATAAAAGG + Intronic
958589437 3:96135813-96135835 GGGGTGTACTTAAGGGTGAATGG - Intergenic
965815039 3:172627716-172627738 GTATTGTACTTTAAGATAAATGG - Intergenic
965906444 3:173712983-173713005 ATGATATACTTAAAGACAAAGGG + Intronic
966335923 3:178868135-178868157 GTGATACAGTTAAGGATACAGGG + Intergenic
967335980 3:188345249-188345271 GAGATGTCCTTAAACATAAATGG + Intronic
971261456 4:25060687-25060709 GTGATATTTTTAAGGGTAAAGGG + Intergenic
971270490 4:25139827-25139849 GTGAAGGACTTAATGATATAAGG + Intronic
973689611 4:53412219-53412241 CTTAAGTACTTAAGGGTAAAGGG - Intronic
975998482 4:80343080-80343102 GGGATGTACATAATGAGAAAGGG + Intronic
976106955 4:81629519-81629541 GTGAGGTTCTTGAGGACAAAGGG - Intronic
977767824 4:100821404-100821426 GTGATGTGCTGAAGGAGCAAGGG - Intronic
978748998 4:112225952-112225974 AAGATGTTCTTAAAGATAAAAGG - Intergenic
978844010 4:113250672-113250694 GTGTTGTATTTAAGGATCCAAGG - Intronic
980430418 4:132686706-132686728 GAGAAATACTTAAGGTTAAATGG - Intergenic
981674454 4:147325018-147325040 GTGACATACCTAAGGAGAAATGG + Intergenic
982014257 4:151137436-151137458 GTTAAGCACTTAAGGATATATGG - Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984572125 4:181406731-181406753 GTGATGTACTGAAAGATCAGAGG - Intergenic
987431036 5:17833318-17833340 ATGATGTATACAAGGATAAAGGG - Intergenic
987648396 5:20706923-20706945 TTTATGTAATGAAGGATAAAAGG + Intergenic
988114300 5:26864802-26864824 GTGCTGTACTTAAGACAAAAAGG - Intergenic
988747933 5:34161994-34162016 TTTATGTAATGAAGGATAAAAGG - Intergenic
992124052 5:73623812-73623834 GTGAAGTATGTAAGGATGAATGG + Intergenic
992822832 5:80515347-80515369 GTGATGTACCTGAGGGTAACAGG + Intronic
996414230 5:123192637-123192659 GTGATATACATTAGGACAAATGG + Exonic
998711960 5:144836303-144836325 GGGATTTAGTTAAGGATAAAGGG + Intergenic
998938016 5:147251180-147251202 GTGATGTCCTTCTGGATATAAGG - Intronic
999018896 5:148141390-148141412 GGGAGGTAATTAAGGTTAAATGG + Intergenic
1001074273 5:168613863-168613885 CTGATGTATTTAGGGGTAAAGGG + Intergenic
1001081937 5:168673612-168673634 CTGAGGTATCTAAGGATAAAGGG - Intronic
1002669492 5:180855074-180855096 CTGAAGTATTTAGGGATAAAGGG + Intronic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1005168825 6:22957624-22957646 GTGATGTAATGAAGGAAGAAAGG - Intergenic
1005247151 6:23900190-23900212 TTGATGTATTTAAAGGTAAATGG + Intergenic
1005545516 6:26865077-26865099 TTTATGTAATGAAGGATAAAAGG - Intergenic
1006193844 6:32225236-32225258 CTGATGGATTTAAGGGTAAAGGG - Intergenic
1006342971 6:33456760-33456782 GTGATCAACTTAAGTATGAATGG - Exonic
1007487633 6:42192903-42192925 CTGAAATACTTAGGGATAAACGG + Intronic
1007990773 6:46253563-46253585 GGTATGTGCTTAAGGTTAAAGGG + Intronic
1008824413 6:55675720-55675742 GTGATGTCATTAAGGTTACATGG - Intergenic
1009016218 6:57905843-57905865 TTTATGTAATGAAGGATAAAAGG - Intergenic
1012072575 6:94641406-94641428 GAGAGGTAGTAAAGGATAAAAGG + Intergenic
1013250840 6:108331672-108331694 GTGAGGTAATTAGGCATAAATGG + Intronic
1014334171 6:120111118-120111140 GTACTGTACATAAGGAAAAAAGG - Intergenic
1014341593 6:120214956-120214978 GTGATGACCTTAAAGATAAATGG + Intergenic
1014791198 6:125674371-125674393 GTGTTGTACTTATGAATCAATGG - Intergenic
1015318197 6:131841588-131841610 GTGATTTAATTAAACATAAATGG - Intronic
1016742734 6:147545584-147545606 GAAATGTAGTTAAGGATAAGCGG + Intronic
1016929841 6:149393787-149393809 GTTCTTTACTTAATGATAAAAGG - Intronic
1017998709 6:159558632-159558654 AGGATGTACTTCAGGAAAAAGGG + Intergenic
1018231513 6:161680207-161680229 GTGCTCTAATTAAGGAGAAAGGG - Intronic
1018577515 6:165274872-165274894 GTGATGTACTTATGGATATGAGG - Intergenic
1020872291 7:13646671-13646693 GTGAGGTACTTTAGAATGAACGG + Intergenic
1027337485 7:77168868-77168890 GTGATGCATTTAGGTATAAAGGG - Intronic
1027754234 7:82190690-82190712 GTGATGGATTTAAGGATATTGGG - Intronic
1027936471 7:84610306-84610328 GTGGTATACTTAATGAAAAATGG - Intergenic
1029327170 7:99819896-99819918 GTGATTTAGTTAAGGTTAACAGG - Intergenic
1029778258 7:102701933-102701955 GTGATGCATTTAGGTATAAAGGG + Intergenic
1031945832 7:127839454-127839476 GTGAACTACCTAAGCATAAAAGG - Intronic
1032951168 7:136915127-136915149 GAAATGTACTTCAGGATTAAAGG + Intronic
1033300322 7:140178933-140178955 GTGATCTAGTTCAGGAGAAATGG - Intergenic
1036634908 8:10542497-10542519 GTTTTGTATTTAAGAATAAAGGG + Intronic
1037373024 8:18200523-18200545 GGGATCTACTTAAGGGTAAAGGG + Intronic
1040087405 8:43359720-43359742 GTGATCTATATAAGGATAACTGG - Intergenic
1040405092 8:47093227-47093249 GTGATCTATATAAGGATAAATGG + Intergenic
1040926630 8:52690916-52690938 CTGAAGTATTTATGGATAAAGGG - Intronic
1041646015 8:60253468-60253490 GAGATGCAGTTGAGGATAAATGG - Intronic
1043084034 8:75804877-75804899 GTAATGTAATTAAAGATATATGG - Intergenic
1045511968 8:102818717-102818739 GTGATGTACTGTAGGATCATGGG + Intergenic
1046501179 8:115079020-115079042 GTAATGTATTTGAGGATACAAGG - Intergenic
1047833467 8:128661334-128661356 CTGACGTATTTAGGGATAAAGGG + Intergenic
1048668716 8:136693432-136693454 AGGATGTACTTGAGGATAGAGGG - Intergenic
1050366567 9:4878811-4878833 GGGATGTCCTTAAGGATAGTTGG + Intronic
1050768443 9:9165933-9165955 GTGATACACTTAAGGGGAAAAGG - Intronic
1051819153 9:21144225-21144247 GAGATGTACCTAATGTTAAATGG + Intergenic
1052959097 9:34279292-34279314 AGGATGTGCTTAAGGATACATGG + Intronic
1055162403 9:73146155-73146177 GTGGTGGCCTTAAGGATAAGGGG - Intergenic
1055677371 9:78678431-78678453 ATGATGTACGTCAGAATAAAGGG + Intergenic
1055902186 9:81253469-81253491 GTGACTTACTTAAGGTTGAATGG - Intergenic
1057098342 9:92333127-92333149 GTGATGCACTAAGAGATAAAGGG + Intronic
1059926215 9:119211728-119211750 GTGATGCACATACGGATGAATGG + Intronic
1187201742 X:17140561-17140583 CTGATGGACACAAGGATAAATGG - Intronic
1188934541 X:36157798-36157820 GTGATGTACTTTAGAATAACTGG + Intergenic
1189453418 X:41161159-41161181 TTGAAGTATTTAAGGGTAAAAGG + Intronic
1189842408 X:45094490-45094512 GTGCTGGACTTAAGGAGATATGG - Intronic
1194409168 X:93536490-93536512 GTGATGTACTCAAGCATATAAGG + Intergenic
1194432150 X:93822171-93822193 ATAATGTAGTTAAAGATAAAAGG - Intergenic
1195174314 X:102300298-102300320 GTCATGTGCTTGAGGATATATGG - Intergenic
1195184551 X:102386795-102386817 GTCATGTGCTTGAGGATATATGG + Intronic
1195405524 X:104508980-104509002 GTGATGTGCTTAAGGACACAGGG + Intergenic
1195827479 X:109018022-109018044 GTGATGGTCTTAAGGAAAAAGGG - Intergenic
1196038607 X:111175286-111175308 GAAATGTACTTAAGTATAAAAGG + Intronic
1196179372 X:112673076-112673098 GTGATTTACTCAAGGGTGAAGGG + Intronic
1196229527 X:113205134-113205156 AAGATGTACTTCAGGCTAAATGG - Intergenic
1196573846 X:117295534-117295556 AGGATGTAATTAAGGTTAAATGG - Intergenic
1198656313 X:138917266-138917288 GAGAGGTAATTAAGGTTAAATGG + Intronic
1199175006 X:144777151-144777173 GTAATGTATTTTATGATAAATGG - Intergenic
1199263434 X:145802160-145802182 GAAATGTACTTAAGTGTAAATGG - Intergenic