ID: 1078278962

View in Genome Browser
Species Human (GRCh38)
Location 11:9880052-9880074
Sequence GTCTCACTCATTGTCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9763
Summary {0: 1, 1: 33, 2: 167, 3: 1115, 4: 8447}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078278962_1078278964 23 Left 1078278962 11:9880052-9880074 CCAGCCTGGACAATGAGTGAGAC 0: 1
1: 33
2: 167
3: 1115
4: 8447
Right 1078278964 11:9880098-9880120 AAAAAAAAAAAAAAGATCTCAGG 0: 4
1: 201
2: 1930
3: 12941
4: 57923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078278962 Original CRISPR GTCTCACTCATTGTCCAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr