ID: 1078281835

View in Genome Browser
Species Human (GRCh38)
Location 11:9910009-9910031
Sequence AATCAGTTCCACGTGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078281835 Original CRISPR AATCAGTTCCACGTGGGTGA AGG Intronic
901711579 1:11119657-11119679 AATCACTTCAACCTGGGAGACGG + Intronic
901927152 1:12573448-12573470 AATGAGTTCCATGAGGGTGGAGG + Intronic
902308116 1:15559024-15559046 AATCAGTTGAACCTGGGAGACGG - Intronic
903376880 1:22872138-22872160 ATTCAATTCCACGTGGCTGTGGG + Intronic
906211668 1:44015743-44015765 ACTCAGTGCCATGTAGGTGAAGG - Intronic
906977155 1:50588198-50588220 AATCACTTGAACGTGGGAGATGG + Intronic
911716795 1:101142511-101142533 ATCCAGTTCCATGTGGCTGAAGG + Intergenic
912535299 1:110364049-110364071 AATCAGCTCCACCTGAGTTAGGG + Intronic
913093840 1:115497940-115497962 AAACATTTCCACCTTGGTGAGGG + Intergenic
915442461 1:155953653-155953675 AATCACTTGAACGTGGGAGATGG + Intronic
916212268 1:162368529-162368551 AATCACTGCCACTTGGGTCAGGG + Exonic
916532513 1:165670982-165671004 AACTAGTTCAACGTGGGAGATGG + Intronic
920363520 1:205435861-205435883 AAACAGTTCCCCCTGGCTGAGGG + Intronic
923013558 1:230108136-230108158 AACCAGTTCCACGTGGCTCAGGG - Intronic
923908925 1:238417620-238417642 ACTCAGTTCCATGTGGCTGGGGG - Intergenic
1063121700 10:3109327-3109349 AACCAGGTCCATGTGGGTCAGGG - Intronic
1063132073 10:3186994-3187016 AGTCATTTCCAGGTGGCTGAGGG - Intergenic
1063132742 10:3192636-3192658 AGTCATTTCCAGGTGGCTGAGGG + Intergenic
1063233518 10:4089050-4089072 CATCAGTTCCACTAGGGTGGGGG + Intergenic
1063274587 10:4551251-4551273 AACCTGTTGCAGGTGGGTGATGG + Intergenic
1066025093 10:31348475-31348497 AATCACTTGCACCTGGGTGGTGG + Intronic
1066488569 10:35872487-35872509 AATCAGATCCATGTGGGGAATGG + Intergenic
1068227579 10:54126155-54126177 AATCAGTTGCACCTGGGAGGCGG - Intronic
1068403014 10:56554623-56554645 AAGCAGTTACAAGTGGCTGAAGG - Intergenic
1069299451 10:66888268-66888290 ATTCAGTTCCAAGTGGTTGTGGG - Intronic
1069945051 10:71979811-71979833 AAACAGTTCCATCTGGGTGGTGG - Intronic
1070850495 10:79558812-79558834 AGTCAGTTACACAGGGGTGATGG - Intronic
1070856723 10:79612484-79612506 AGTCAGTTACACGGGGATGATGG + Intronic
1071035670 10:81241176-81241198 AATCACTTGCACCTGGGAGACGG + Intergenic
1072427154 10:95339220-95339242 GATCACATCCACGTAGGTGATGG + Exonic
1075995017 10:126870084-126870106 AATCAGTGGAAAGTGGGTGAAGG + Intergenic
1076024055 10:127098021-127098043 AATCAGTTCACTGGGGGTGAGGG - Intronic
1076148922 10:128147376-128147398 ACTCAGTTCCACATGGCTGGAGG - Intergenic
1077183706 11:1227398-1227420 AGTGAGTGCCACCTGGGTGAGGG + Exonic
1077997841 11:7469211-7469233 AATCAGTGCCAGTTGGGTGGGGG - Intergenic
1078281835 11:9910009-9910031 AATCAGTTCCACGTGGGTGAAGG + Intronic
1079764346 11:24372369-24372391 AAACAGTTCCACATGGTTGTAGG + Intergenic
1080117380 11:28636163-28636185 AACCAGTACCAGGTGGGAGAAGG - Intergenic
1080475068 11:32583103-32583125 AATCACTTCAACCTGGGAGAAGG - Intergenic
1082874077 11:57970521-57970543 AATCACTTCAACCTGGGAGATGG - Intergenic
1083012370 11:59415378-59415400 ACTCAGTTCCACTTGGCTGGGGG - Intergenic
1083772671 11:64877319-64877341 AGTGAGGTCCAAGTGGGTGAAGG + Intronic
1084088668 11:66866311-66866333 GCTCAGATCCACGTGGCTGAGGG - Exonic
1085215328 11:74825900-74825922 ACTCAGTTCCATGTGGCTGGGGG + Intronic
1087058410 11:93955635-93955657 AATCACTTCCCCCTGTGTGATGG + Intergenic
1088392296 11:109327907-109327929 AATCAGTACCCCGAGGATGATGG + Intergenic
1091500703 12:1014848-1014870 AATCACTTCAACCTGGGAGACGG - Intronic
1091914610 12:4261537-4261559 ACTCAGTTCCATGTGGCTGAGGG - Intergenic
1094683187 12:32684226-32684248 TATAAGCCCCACGTGGGTGAGGG + Intronic
1095327968 12:40920903-40920925 AATCAGATCCATGTGGAGGAAGG + Intronic
1100777815 12:97991574-97991596 ATTCAGTTCCATGTGGGTGTAGG + Intergenic
1101868331 12:108540931-108540953 AATCAATCCCAGGTGGATGAGGG + Intronic
1101908042 12:108842396-108842418 AACCAGTTCCACGAGGCTGGTGG - Intronic
1102875978 12:116449018-116449040 AATCACTTGAACGTGGGAGACGG + Intergenic
1108889506 13:55236331-55236353 AATTAGATCCAGGTGGTTGATGG - Intergenic
1115208042 14:30934235-30934257 AATCACTTGAACGTGGGAGACGG + Intronic
1117378505 14:55137422-55137444 GATCAGCTCCACATGGTTGAGGG + Intronic
1121168358 14:91831706-91831728 AATCAGTTCTACATGGATTAAGG + Intronic
1121582181 14:95039441-95039463 AAGCAGTTCAACGTGGATGCCGG - Intergenic
1123891051 15:24780055-24780077 AATCAGTTGAACCTGGGAGACGG - Intergenic
1124163787 15:27299636-27299658 AATCAATTCCACTCAGGTGATGG + Intronic
1126660357 15:51027130-51027152 AATCACTTGAACGTGGGAGACGG - Intergenic
1128949940 15:71868182-71868204 ATTCAGTTCCATGTGGTTGTTGG + Intronic
1129462081 15:75704568-75704590 AGTCACCTCTACGTGGGTGAAGG + Intronic
1129722781 15:77887278-77887300 AGTCACCTCTACGTGGGTGAAGG - Intergenic
1130225464 15:82054828-82054850 AATAAATTCCAGGTGGGTTAAGG + Intergenic
1132785378 16:1654296-1654318 AATCACTTAAACGTGGGAGACGG - Intronic
1133989136 16:10691351-10691373 AATCATTTCCAACTGTGTGAAGG + Intronic
1136235409 16:28910818-28910840 AATCAGTTGCACGTGGTGGAAGG - Intronic
1137030838 16:35522771-35522793 AATCAGTACAATTTGGGTGATGG - Intergenic
1138000596 16:53275116-53275138 AATCACTTGCACCTGGGAGATGG - Intronic
1138106744 16:54291140-54291162 AGGCAGATCCACGTGGGGGAGGG - Intergenic
1140154466 16:72408940-72408962 AAACAGTTCCAAGTGGCTGGGGG + Intergenic
1140529558 16:75652463-75652485 AATCAGGTGAAGGTGGGTGATGG - Intronic
1141431370 16:83971929-83971951 AGCCGCTTCCACGTGGGTGAGGG + Intronic
1143584146 17:7843081-7843103 AGTCAGTTCCCCGTGGGAAAGGG + Intronic
1144199809 17:12930318-12930340 AATCACTTCAACCTGGGAGACGG - Intronic
1144347434 17:14362142-14362164 AATCATTTCCTTCTGGGTGAGGG + Intergenic
1144994503 17:19258093-19258115 AACCAGTTAGATGTGGGTGAGGG + Intronic
1149577092 17:57721900-57721922 AATGAGATCAAGGTGGGTGATGG + Intergenic
1150257260 17:63757409-63757431 ATTCAGTTCCTTGTGGGTGTAGG - Intronic
1151059105 17:71070353-71070375 ACTCAGTTCCACATGGCTGGGGG - Intergenic
1152213518 17:79018235-79018257 AATCACTTGAACGTGGGAGATGG - Intergenic
1153639845 18:7147418-7147440 ATTCAGTTCCACATGGCTGCAGG + Intergenic
1153826038 18:8875678-8875700 AATCAGTTCCCTGTGGCTGAGGG + Intergenic
1157056668 18:44237301-44237323 ATTTAGTTCCACGTGGTTGCAGG - Intergenic
1159275794 18:66219903-66219925 AATCACTTCCACCTGGGAGGTGG + Intergenic
1159964595 18:74583091-74583113 AATCGCTTGAACGTGGGTGATGG - Intronic
1163392850 19:17040927-17040949 AATCAGTTTCAGGGGAGTGATGG - Intergenic
1165081772 19:33311109-33311131 ACTCAGTTCCAGGAGGGTGGCGG - Intergenic
1165983037 19:39741701-39741723 AATCAGCTCAAGGTGGATGAAGG - Intergenic
1166531307 19:43545151-43545173 ACCCAGTTCCTCGTGGGTGATGG - Intronic
1168613879 19:57822241-57822263 AATCACTTGAACCTGGGTGACGG - Intronic
929203878 2:39267732-39267754 AATCAGTTCCAAATGGGTTAAGG + Intronic
929249016 2:39732404-39732426 ATTGAGTTCCACATGGCTGACGG - Intergenic
929870809 2:45757759-45757781 AATGAATTCCATGTGGGGGATGG - Intronic
931646026 2:64422753-64422775 AGTAAGTTCCACGTGGAAGAAGG + Intergenic
931913350 2:66926173-66926195 ATTCAGTTCCTCGTGGCTGTTGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936813760 2:116434098-116434120 AAGCAGTTCCACATGGCTGGGGG + Intergenic
936820261 2:116511213-116511235 AACCAGTTTCACCTGGGTGATGG - Intergenic
937340920 2:121089959-121089981 AATCATTTGCACGTGGGAGGTGG + Intergenic
937745703 2:125411053-125411075 AATCAGCTTCAGGTGGGTTATGG + Intergenic
937781522 2:125843995-125844017 ATTCAGTTCCTCATGGGAGAGGG + Intergenic
938057206 2:128225095-128225117 AATCACTTCAACGTGGGAGGCGG - Intergenic
938228235 2:129636119-129636141 AATCAGTTCCACCTTGATGTTGG - Intergenic
938395402 2:130942947-130942969 AATTAGTTCCAGTTGGTTGATGG + Intronic
939964914 2:148600660-148600682 ATTCAGTTCCTTGTGGGTGTAGG - Intergenic
941291229 2:163678305-163678327 AATCAGTTGAACGTGGGAGGTGG - Intronic
941907953 2:170735082-170735104 AATCACTTCAACTTGGGTGGCGG + Intergenic
943520644 2:188944736-188944758 TACCAGTTCCAGGTGGGTGTGGG - Intergenic
944009717 2:194959093-194959115 CATCAGTTCCATGTCCGTGAGGG - Intergenic
945687917 2:212994839-212994861 AATCACTTCAACCTGGGAGATGG + Intergenic
946250974 2:218412119-218412141 AATCAGTTGAACCTGGGAGACGG - Intergenic
947240600 2:227990087-227990109 ATTCAGTTCCATGTGGTTGTAGG - Intronic
1169752708 20:9010971-9010993 TTACAGTTCCACGTGGCTGAGGG - Intergenic
1170605996 20:17875474-17875496 ACTTTGTCCCACGTGGGTGAGGG + Intergenic
1171422353 20:25025654-25025676 ACTCAGTTCCACGCGACTGAGGG + Intronic
1173379868 20:42530568-42530590 AATCAGATCCATGTGGGAAAAGG + Intronic
1174400430 20:50273092-50273114 CATCAGCTCCACGAGGGTAAGGG - Intergenic
1175178585 20:57128861-57128883 ATTCAGTTCCTTGTGTGTGAAGG + Intergenic
1175267471 20:57711125-57711147 AATCAGGACTACGTGGGAGAGGG - Intronic
1177548365 21:22589047-22589069 AATCAGTTGCACCTGGGAGGCGG + Intergenic
1178723060 21:35027172-35027194 AATCAGTTTCATGTGGGGGTAGG - Intronic
1184694088 22:46130254-46130276 AATCCATTCTATGTGGGTGAAGG + Intergenic
1185398052 22:50602528-50602550 CATAAGTTCCACGAGGGGGAAGG + Intronic
949704107 3:6795944-6795966 AATCACTTCAACCTGGGAGATGG - Intronic
950783679 3:15414440-15414462 AATCACTTGAACGTGGGAGACGG - Intronic
953250380 3:41240829-41240851 AATGAGTCACACTTGGGTGAAGG - Intronic
956850063 3:73220768-73220790 AATCACTTGAACGTGGGAGACGG - Intergenic
963255803 3:143143753-143143775 AATCTGTTCCATTTTGGTGAAGG + Intergenic
963367691 3:144359306-144359328 AATTAGGTCCACATGGTTGATGG + Intergenic
964569090 3:158093610-158093632 AATCAGTTTAATGTGTGTGAGGG - Intergenic
966402222 3:179559611-179559633 AATCACTTCAACCTGGGAGATGG + Intergenic
966707680 3:182934374-182934396 AATCAGTTGCCCGTGTGTGTGGG - Intergenic
968799195 4:2731107-2731129 AATCACTTCAACGTGGGAGGCGG + Intronic
970897454 4:21120082-21120104 CATCAGGTCAACGTGGGGGAGGG + Intronic
970899586 4:21143414-21143436 ATTCAGTTCCATGTGGTTGTAGG - Intronic
973135231 4:46698916-46698938 CATGAGTTCCAGGTGGGTGCAGG + Intergenic
974221838 4:58984644-58984666 AATCACTTGAACGTGGGAGACGG + Intergenic
974866643 4:67589264-67589286 AATCAGTTACAAGTTGGTGAAGG - Intronic
976755779 4:88496634-88496656 AATCACCTCCATGTGGATGAAGG + Intronic
978986748 4:115022901-115022923 TTTCAGTTCTACGTGGCTGAGGG - Intronic
980268662 4:130554176-130554198 AATCACTTCAACCTGGGAGATGG + Intergenic
981094648 4:140765942-140765964 AATCAGTTGAACCTGGGAGATGG - Intergenic
983953006 4:173663847-173663869 ATTGAGCTCCACGTGGGTGATGG + Intergenic
985712064 5:1435132-1435154 GACCAGATCCACGTGGGAGAAGG - Intronic
988185300 5:27853259-27853281 TCACAGTTCCACGTGGCTGAGGG - Intergenic
988288798 5:29257512-29257534 AATGAGTTCCAAGAAGGTGAGGG - Intergenic
988307416 5:29510367-29510389 ATTCAGTTCCATGTGGCTGCAGG - Intergenic
989277220 5:39603149-39603171 AATCAGTTTCACTGGGCTGAAGG + Intergenic
990685556 5:58296664-58296686 ATTCAGTTGCTTGTGGGTGATGG + Intergenic
997499038 5:134356865-134356887 ATTTAGCTCCACGTGGATGAGGG + Intronic
999176363 5:149634511-149634533 ATTCAGTAGCACGTGGGTTATGG + Exonic
1001205882 5:169762831-169762853 AATAAATTCCAGTTGGGTGATGG - Intronic
1003291707 6:4784982-4785004 ACTCAGTTCCACATGGCTGGGGG - Intronic
1003428133 6:6011684-6011706 AATCAACTCCAGGTGGGTTAAGG + Intergenic
1006791927 6:36707268-36707290 AATCACTTCAACGTGGGAGGCGG + Intronic
1006981859 6:38153806-38153828 CATCAGATCCAGGTGGGTGAGGG + Exonic
1007837991 6:44690807-44690829 AATCAGTTGAACCTGGGAGATGG + Intergenic
1008564133 6:52750804-52750826 AGTCGCTTCCACTTGGGTGAAGG + Intronic
1014510502 6:122315777-122315799 AATCAGTTCCCTGTGGTTGTAGG - Intergenic
1017440067 6:154456618-154456640 AATCAGTTGAACCTGGGAGATGG + Intronic
1017753291 6:157508963-157508985 TTTCAGTTCCACGTGGTTGGAGG + Intronic
1017852462 6:158316829-158316851 AATCAGTTCCTTGTGGTTGTAGG + Intronic
1018174490 6:161167131-161167153 AAACAGTTGAATGTGGGTGATGG + Intronic
1021275899 7:18650661-18650683 AATCAGCTCCACATGGGAAAAGG - Intronic
1021478514 7:21090239-21090261 AATCATCTCCAAGTGGGCGAAGG + Intergenic
1022561035 7:31349742-31349764 AATCAGTCCCAACTGGGAGACGG - Intergenic
1026051405 7:66950137-66950159 AATCAGTTCAACATGGGAGGTGG + Intronic
1026996667 7:74621457-74621479 AATCACTTGAACGTGGGAGATGG - Intergenic
1028025014 7:85826436-85826458 ATTCAGTTCCATGTGGTTGCAGG - Intergenic
1030013476 7:105195134-105195156 AATCACTTCAACGTGGGAGGCGG - Intronic
1033571137 7:142629716-142629738 AGTCAGTTCCACCTTGGTCAGGG - Intergenic
1034714505 7:153228727-153228749 ATGCTGTTCCACGTGGCTGAGGG + Intergenic
1034940989 7:155230195-155230217 AATCAGGTCCGCGTGGTGGAGGG - Intergenic
1045242936 8:100418022-100418044 ATTCAGTTCCAGGTGGGTTTGGG - Intergenic
1045362308 8:101444163-101444185 AATGATTTCCACGTGGGATACGG - Intergenic
1048030603 8:130628087-130628109 ACACAGTTCCACGTGGCTGGGGG - Intergenic
1048285836 8:133141007-133141029 AGTCAGTTCCCCATGGGTGTTGG - Intergenic
1048453839 8:134559218-134559240 AACCTGTTGCAGGTGGGTGAGGG - Intronic
1049564038 8:143328635-143328657 GAACATTCCCACGTGGGTGAGGG - Intronic
1049664410 8:143836669-143836691 AATCAGCACCAGGTGGGGGATGG + Intronic
1051616977 9:19015864-19015886 ATTCAGATGCAGGTGGGTGATGG - Intronic
1051690071 9:19702331-19702353 TATCAGTTCCAACTGGGAGAAGG - Intronic
1052534976 9:29734393-29734415 AATCACTTCAACTTGGGAGACGG + Intergenic
1053410215 9:37911496-37911518 ACTAAGTTCCCCCTGGGTGATGG + Intronic
1053493543 9:38530403-38530425 AATCACTTGCACTTGGGAGATGG + Intergenic
1055329988 9:75173624-75173646 AATCACTTACACCTGGGAGACGG + Intergenic
1055446048 9:76383272-76383294 ACTCAGTTCCACATGGCTGGTGG + Intergenic
1056036448 9:82611213-82611235 AATGAGTTCCAGGTGGGCAAAGG + Intergenic
1056478847 9:86980556-86980578 ATTCAGTTCCATGTGGTTGTAGG + Intergenic
1056600827 9:88045564-88045586 AATCACTTGCACCTGGGTGGTGG - Intergenic
1057413848 9:94844140-94844162 AATCAGTTGAACCTGGGAGATGG - Intronic
1058707898 9:107652351-107652373 AATCACTTCAACCTGGGAGATGG + Intergenic
1059049301 9:110905430-110905452 AATCGCTTCAACCTGGGTGACGG - Intronic
1059166777 9:112084540-112084562 ATTCAGTTCCACCCGGGTCAGGG + Intronic
1059215641 9:112559259-112559281 AACCAGATCCACAGGGGTGAAGG + Intronic
1060967220 9:127718002-127718024 CAACAGTTCCACGTGGCTGGTGG - Intronic
1189994489 X:46625853-46625875 ATTCAGTTCCATGTGGTTGTAGG - Intronic
1200244094 X:154513541-154513563 AATCAGTTGAACCTGGGTGGCGG + Intronic
1202029703 Y:20558689-20558711 AATCACTTACACCTGGGAGATGG + Intergenic