ID: 1078285445

View in Genome Browser
Species Human (GRCh38)
Location 11:9949522-9949544
Sequence TATCTCAGTCAGTTAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078285445_1078285448 11 Left 1078285445 11:9949522-9949544 CCTTTTCTTAACTGACTGAGATA 0: 1
1: 0
2: 0
3: 25
4: 243
Right 1078285448 11:9949556-9949578 TTTCCTTTAATCTATTAATGGGG 0: 1
1: 7
2: 59
3: 317
4: 1187
1078285445_1078285447 10 Left 1078285445 11:9949522-9949544 CCTTTTCTTAACTGACTGAGATA 0: 1
1: 0
2: 0
3: 25
4: 243
Right 1078285447 11:9949555-9949577 TTTTCCTTTAATCTATTAATGGG 0: 1
1: 0
2: 7
3: 96
4: 732
1078285445_1078285446 9 Left 1078285445 11:9949522-9949544 CCTTTTCTTAACTGACTGAGATA 0: 1
1: 0
2: 0
3: 25
4: 243
Right 1078285446 11:9949554-9949576 CTTTTCCTTTAATCTATTAATGG 0: 1
1: 0
2: 2
3: 42
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078285445 Original CRISPR TATCTCAGTCAGTTAAGAAA AGG (reversed) Intronic
900416842 1:2539299-2539321 TACCTTAGTCAGATGAGAAATGG + Intergenic
900417034 1:2540089-2540111 TACCTTAGTCAGATGAGAAATGG - Intergenic
900850789 1:5141332-5141354 TATTTCAGACTGGTAAGAAATGG - Intergenic
906891755 1:49723998-49724020 TATGTCAGTCAGTAGAGTAAGGG + Intronic
908264767 1:62367434-62367456 TATATCTGGCAGTTGAGAAAGGG - Intergenic
908981143 1:69960735-69960757 TATCTCAATCAATGCAGAAAAGG + Intronic
909196671 1:72635377-72635399 TAACATATTCAGTTAAGAAAAGG + Intergenic
910070195 1:83204605-83204627 TATCTCAATAACTGAAGAAAGGG + Intergenic
913042129 1:115037293-115037315 TATCTCAGTATGTTCAAAAAAGG + Intergenic
916813564 1:168328248-168328270 TATCACAATCTGTAAAGAAACGG - Intergenic
917498567 1:175564957-175564979 TATCTCAGTCTAGTAATAAATGG + Intronic
917758430 1:178128314-178128336 TATGTTATTCAGTTAATAAATGG - Intronic
919535871 1:198787225-198787247 TATCTAAGTCAGTCAACAACAGG + Intergenic
919636925 1:200012277-200012299 TAACACAGTTGGTTAAGAAATGG + Intergenic
919966799 1:202535177-202535199 CATATCAGTCAGTTAAGCAGGGG + Intronic
921034407 1:211362719-211362741 TGTGTTAGTCATTTAAGAAAGGG - Intronic
921173985 1:212577273-212577295 TTTATCTGTCAGTTAAAAAAAGG - Intronic
921695099 1:218200252-218200274 TATCTTAGTAATTTAATAAATGG - Intergenic
921835432 1:219773319-219773341 TATCTGACTCTGTGAAGAAAAGG + Intronic
921847368 1:219898388-219898410 TATCTCTATCAGAAAAGAAACGG - Intronic
923164971 1:231351887-231351909 TAACTCAGTGAGTCAAGATAGGG - Intronic
923373655 1:233338578-233338600 TATCTAAGTAAGTGAGGAAATGG + Intronic
1064742971 10:18452090-18452112 TATCTTAGTAAATTAATAAATGG + Intronic
1065665960 10:28060907-28060929 TATCTAAGCCAATGAAGAAAAGG + Intronic
1066002687 10:31119226-31119248 TCTCACGGTCAGTTAGGAAACGG - Intergenic
1066699238 10:38109245-38109267 TATCTCAGTAGGTGCAGAAAAGG + Intronic
1067164906 10:43857478-43857500 TATCTAAGGCAGATAAGAGAAGG + Intergenic
1068441441 10:57060319-57060341 TATCTCAATAAATTCAGAAAAGG + Intergenic
1068930983 10:62589950-62589972 TATCTCACTCAGCAAAGAAAAGG + Intronic
1070117900 10:73546806-73546828 AATGTCTGTCAGTAAAGAAATGG - Intronic
1070496069 10:77023991-77024013 CATCTCAGTAACTTTAGAAATGG + Intronic
1071205284 10:83268587-83268609 TAACTCAGTAAATTCAGAAATGG - Intergenic
1071785599 10:88896378-88896400 TGTCTCTGTCATTTAAGACATGG + Intronic
1073272870 10:102281079-102281101 TGTTTCAGCCAGTTAGGAAATGG + Intronic
1074487593 10:113901658-113901680 TTTTTCAGTGAGTTAACAAAAGG + Exonic
1076863173 10:133151896-133151918 TGTGTCAGTCAGGGAAGAAAGGG - Intergenic
1078285445 11:9949522-9949544 TATCTCAGTCAGTTAAGAAAAGG - Intronic
1079736690 11:24006088-24006110 TATGTCAGTGAGTTGATAAAGGG + Intergenic
1079881650 11:25935405-25935427 CATCTCATTCAGTTAATAAATGG - Intergenic
1081505954 11:43717421-43717443 TATCTCAGACACTGGAGAAAAGG - Intronic
1081550780 11:44109892-44109914 TCTTTCAGTCAGTGATGAAAGGG - Intronic
1082137286 11:48563810-48563832 TATCTCAATAAATGAAGAAAAGG - Intergenic
1082675126 11:56089321-56089343 TATCACAGTCATGAAAGAAAAGG + Intergenic
1084914790 11:72420729-72420751 TATTTCAGGCAGATAAGAGAGGG + Intronic
1088594591 11:111431048-111431070 TGCCTCAGTCAGTGACGAAAGGG + Intronic
1089149241 11:116352052-116352074 TTTATCAGTCAGTTCAGAACTGG - Intergenic
1089732304 11:120526886-120526908 TATCACAGTCAGGTTATAAATGG + Intronic
1090903449 11:131052883-131052905 TATGTCAATAAGTTCAGAAAAGG - Intergenic
1092569402 12:9706588-9706610 TATCTCAGTAAATGCAGAAAAGG - Intergenic
1093870956 12:24290255-24290277 TATCTTAGTCAGTAAACAGAGGG + Intergenic
1093954326 12:25198788-25198810 TATGACCTTCAGTTAAGAAAAGG + Intronic
1095918178 12:47501454-47501476 TATCTCAGTAAATGCAGAAAAGG + Intergenic
1096025679 12:48359086-48359108 TATCTCAGCCAATCAAGTAATGG - Intergenic
1096475046 12:51904131-51904153 TAGTGCAGTCAGGTAAGAAAAGG + Intergenic
1097344257 12:58473641-58473663 TATCTCAATCAATGCAGAAAAGG - Intergenic
1099183690 12:79495573-79495595 TATCTCAATAAATGAAGAAAAGG - Intergenic
1099556106 12:84109641-84109663 TATCTCAATAAATTCAGAAAAGG + Intergenic
1100890228 12:99117430-99117452 TATCTCAGTAGGTACAGAAAAGG - Intronic
1100907056 12:99313675-99313697 TATCTCAGTAGGTGCAGAAAAGG + Intronic
1100920526 12:99480322-99480344 TTTCTTAGTAAGTAAAGAAATGG - Intronic
1101343298 12:103862037-103862059 TAACTAAATCAGTTAGGAAATGG + Intergenic
1101457812 12:104854915-104854937 TATCTCACTGTGGTAAGAAAAGG - Intronic
1103211715 12:119171946-119171968 TATCTCAGTCAGTGAGCAGAGGG + Intergenic
1105929270 13:25036999-25037021 TATCTCAGTGAGTAGAGGAATGG - Intergenic
1108896360 13:55334166-55334188 TATCTAAGACAATAAAGAAAAGG + Intergenic
1111788890 13:92827524-92827546 TATCTCAGTTAGCTCAGAACTGG - Intronic
1114809500 14:25880834-25880856 TATCTCAGTCAGGAAAGAACTGG - Intergenic
1114902623 14:27083696-27083718 TCTCTCAGACAGTTTGGAAAAGG - Intergenic
1115518743 14:34211917-34211939 GGTCTGAGTCACTTAAGAAAAGG - Intronic
1115554749 14:34535776-34535798 AATCTCAGTTATTCAAGAAACGG + Intronic
1117485193 14:56189185-56189207 TATATCAGTCAGTTGAGACCAGG + Intronic
1118432278 14:65731286-65731308 TATCTCCCTCAGTCAAGAGAAGG + Intronic
1118957925 14:70499941-70499963 TATCTCAATAAATGAAGAAAAGG + Intergenic
1120065509 14:80036208-80036230 TATCTCAGTAAGTTCAGATAAGG + Intergenic
1120207918 14:81606284-81606306 ATTATCAGTCAGTGAAGAAAAGG + Intergenic
1121713611 14:96057138-96057160 TATCCCAGTCAGGAAACAAATGG + Intronic
1121905522 14:97738821-97738843 TATCTCAATCAATGCAGAAAAGG - Intergenic
1122058467 14:99121100-99121122 TAATTCAGCCAGGTAAGAAATGG + Intergenic
1126717907 15:51541042-51541064 TATCACAGTAATTCAAGAAACGG + Intronic
1126779455 15:52126252-52126274 TCTATGAGTCAGTAAAGAAACGG + Intronic
1126842389 15:52729846-52729868 TCTCTCAGTCAATGAAGAATGGG - Intergenic
1129580755 15:76807280-76807302 TATCTCAGTTGGTGCAGAAAAGG - Intronic
1133439131 16:5805976-5805998 TCTCTCAGTGAGTCAATAAATGG + Intergenic
1133561114 16:6951216-6951238 TTTCTTAACCAGTTAAGAAAAGG + Intronic
1138172717 16:54867971-54867993 TATAGCAGACAGTCAAGAAATGG + Intergenic
1140376825 16:74451427-74451449 TATGTCAGTCAGGTTAGACAAGG + Intergenic
1140954634 16:79850586-79850608 TGTCTCAGTCAAATAAAAAAGGG + Intergenic
1146165892 17:30588281-30588303 TATCTCAGTAAATGCAGAAAAGG - Intergenic
1149805913 17:59618314-59618336 TATGTGAGACAGTTAAGTAAAGG + Intergenic
1154289346 18:13093447-13093469 CATCTCAGTCAGGAAAGATAAGG - Intronic
1155505996 18:26533353-26533375 TATTTCAGTCAAGTAGGAAAAGG + Intronic
1155589704 18:27412460-27412482 TATCTCTGTCAGTTATGATCTGG - Intergenic
1155943885 18:31826340-31826362 TATTTCAGGCAGATAGGAAAAGG - Intergenic
1158298493 18:56026346-56026368 GATTTAAGTGAGTTAAGAAATGG + Intergenic
1162184656 19:8895480-8895502 TCTCTCAGTCAGTTTGGAAGTGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1165289041 19:34868315-34868337 TTTCTCAATCAGATAGGAAAAGG - Intergenic
1168043037 19:53774192-53774214 TAGCTCAGTCAGTCATTAAAAGG - Intergenic
925938746 2:8794231-8794253 TCTTTCACTGAGTTAAGAAAAGG - Intronic
928448762 2:31358906-31358928 CATCTCAGTATGTAAAGAAAAGG + Intronic
931164095 2:59727030-59727052 TATATCTGGCAGTTGAGAAATGG + Intergenic
931860875 2:66353110-66353132 TATCTCAAACAGTGAAGAAATGG - Intergenic
932278932 2:70472826-70472848 TATCTGAGGAAGTTATGAAATGG - Intronic
932342293 2:70973264-70973286 TTTTTAAGTCAGTTAAGAGAAGG + Intronic
932480129 2:72034170-72034192 TATGTCACACAGTTAGGAAATGG - Intergenic
934312187 2:91877694-91877716 TATCTCTGGCAGTGAAGACAAGG - Intergenic
936593113 2:113822317-113822339 TATCTCAGACATGTCAGAAAAGG + Intergenic
936704590 2:115057153-115057175 TATCTAAGAGAGTTAAGAAAGGG - Intronic
936733023 2:115406854-115406876 TTTCTCTATCAATTAAGAAAAGG - Intronic
937461945 2:122096925-122096947 TATCTATTTCAGTTATGAAAAGG - Intergenic
937573907 2:123395889-123395911 TATCTCAATCGATGAAGAAAAGG + Intergenic
939221194 2:139303416-139303438 TATTTGTATCAGTTAAGAAAAGG + Intergenic
939455138 2:142424301-142424323 GCTCTCAGTCATTGAAGAAAGGG - Intergenic
939664516 2:144934517-144934539 TATTTCAGTCTGTTCAGAAAAGG + Intergenic
940780925 2:157932936-157932958 TTTCTCAGTCAGAGAACAAAGGG + Intronic
941026824 2:160465533-160465555 GATCTTACTCAGGTAAGAAAAGG + Intronic
941205170 2:162563000-162563022 TTTCTGAGTCAGCTAAGAGATGG - Intronic
941757381 2:169202202-169202224 TATCACAGTCTGCTAGGAAAAGG + Intronic
943042079 2:182815531-182815553 TAAACCAGCCAGTTAAGAAAGGG + Intergenic
944382376 2:199126436-199126458 TATCTAAGTATGTTAACAAAGGG + Intergenic
946000308 2:216476726-216476748 TATTTCATACAGTGAAGAAATGG + Intronic
947182569 2:227425068-227425090 TATCTGATTCAGCTAAGAAGTGG + Intergenic
947260542 2:228217100-228217122 TGTCTCAGTCACATTAGAAAAGG + Intergenic
947423295 2:229960072-229960094 TATCACATTCATTTCAGAAAAGG - Intronic
1169820261 20:9702578-9702600 CATCTAAGTCAGTTCAGAGATGG - Intronic
1170961269 20:21027951-21027973 GATCTCAGTCACTTTTGAAAAGG - Intergenic
1172050182 20:32111082-32111104 GTTCTCAGTCAGCTAAGAGAAGG - Intronic
1172923498 20:38509027-38509049 TTTTTCAATCTGTTAAGAAATGG + Intronic
1173427780 20:42958007-42958029 TATTGCAGTCAGTCAAGCAAGGG + Intronic
1173762939 20:45579625-45579647 TAGTTCAGTTAGTAAAGAAAAGG + Intergenic
1175396919 20:58671242-58671264 TATTTCATTCAGGTCAGAAATGG - Exonic
1176744024 21:10634973-10634995 TATCTCAGTAGATGAAGAAAAGG + Intergenic
1176872515 21:14095189-14095211 TGCCTCAGTGAGTTAACAAAAGG + Intergenic
1177912906 21:27054056-27054078 CAGCTCAGGGAGTTAAGAAAAGG + Intergenic
951653381 3:24977987-24978009 TATCTCAATCAATGCAGAAAAGG - Intergenic
953116072 3:39993648-39993670 TTTCTCAGTGAATTAAGAAAAGG - Intronic
955667514 3:61366190-61366212 TATCTCAGTAGGTGCAGAAAAGG + Intergenic
955774938 3:62422923-62422945 CATCCCAGACAGTTAATAAATGG - Intronic
956644085 3:71439400-71439422 TATTTCTTTCAGCTAAGAAAAGG + Intronic
956988991 3:74741136-74741158 GATCTCAGTTAGTGCAGAAATGG - Intergenic
957126748 3:76171378-76171400 AATCTCAGTCAGGTGGGAAAGGG + Intronic
957498479 3:81022076-81022098 AGTCTCAGTCATTTAAGCAATGG - Intergenic
959314828 3:104790062-104790084 TATATGAGTAAGTGAAGAAATGG + Intergenic
960914814 3:122684328-122684350 TATCTCAGTCCATGAAGAACGGG - Intronic
964512708 3:157470597-157470619 TAACTCAGTCATTTAGAAAATGG + Intronic
965255111 3:166396686-166396708 TATCTCAATAAATAAAGAAAAGG - Intergenic
966647383 3:182261759-182261781 TCACTCAGTGAGTTAAGAAAAGG - Intergenic
967234841 3:187374050-187374072 TACCTCAGTGAGGTAAGAGAGGG + Intergenic
967281500 3:187828149-187828171 CAACTCAGTCAGTCAAAAAAGGG - Intergenic
970581808 4:17480433-17480455 TATCTCAGTCATATGAGAAACGG - Intronic
972449005 4:39178202-39178224 TATCTCAGTGAGTTGAAATAAGG - Intergenic
973147917 4:46851693-46851715 TATCTAGGTCATTAAAGAAAAGG - Intronic
974133205 4:57782046-57782068 TATCTCAATTAGAAAAGAAATGG - Intergenic
974366794 4:60960665-60960687 TATCTGAGTAAGGTCAGAAAGGG - Intergenic
974770101 4:66401383-66401405 TATCTCAGTAAATGCAGAAAAGG - Intergenic
977411618 4:96673494-96673516 TATCTTAGTCAATTCAGACATGG + Intergenic
977641495 4:99362513-99362535 TATCTCAGTCAGGAAAGATCAGG + Intergenic
977885587 4:102249284-102249306 TTACTCATTCATTTAAGAAATGG - Intergenic
978021931 4:103824912-103824934 TATATTAGTGAGTTAAGAAGTGG + Intergenic
979968836 4:127109618-127109640 TATCTCAATCAATGTAGAAAAGG + Intergenic
982716795 4:158817411-158817433 GATCTCAGCCAGGTACGAAAAGG - Intronic
983969675 4:173856472-173856494 TACCTCATAAAGTTAAGAAATGG + Intergenic
986153435 5:5149214-5149236 TTTCTTATTCAGTTAAGTAAGGG + Intronic
987797548 5:22649175-22649197 CATTTCAGGCAGTTAATAAAAGG - Intronic
988450447 5:31337248-31337270 TCTCTCTGGCAGTTAAGAAGCGG + Intergenic
988910793 5:35840344-35840366 TATCTCCATCATTTAAAAAATGG + Intergenic
989026661 5:37075934-37075956 TATTGCACTCACTTAAGAAATGG + Intergenic
989800123 5:45527104-45527126 TATCTCAGTCTGTGTAGGAAAGG - Intronic
989800162 5:45527658-45527680 TATCTCAGTCTGTGTAGGAAAGG - Intronic
990949483 5:61284109-61284131 AATATTAGTCAGTTGAGAAATGG + Intergenic
991084659 5:62637719-62637741 TATTACAGTCAGGTAAGAAAAGG - Intergenic
991326893 5:65443719-65443741 TATCTCAAACAATTCAGAAAAGG + Intronic
993137152 5:83983844-83983866 TAACACAGCCAGGTAAGAAATGG + Intronic
993752378 5:91686859-91686881 TATTTTATTCAGTTATGAAAAGG + Intergenic
995895758 5:117008503-117008525 TATCTCAATCAATGCAGAAAAGG - Intergenic
996632618 5:125653070-125653092 TGTCTCAAAAAGTTAAGAAAGGG + Intergenic
997842262 5:137252684-137252706 TATCTCAGACACCAAAGAAAAGG - Intronic
1000148892 5:158480613-158480635 TTTCTCAGTCCTTAAAGAAAGGG - Intergenic
1003584390 6:7374062-7374084 GATGTCAGTCAGTTATGAAAAGG - Exonic
1004600056 6:17141085-17141107 TATCTCAGACAGCTCAGTAAAGG + Intergenic
1005077484 6:21922702-21922724 TTTCTCACTCAGTTGATAAAGGG + Intergenic
1007056275 6:38888530-38888552 TAAATCAGTCAGTCAAGAAAAGG + Intronic
1008454136 6:51689254-51689276 TATCTCAATCAATGCAGAAAAGG + Intronic
1009479798 6:64142498-64142520 TATAGCAGTCAGTGCAGAAAGGG + Intronic
1012063420 6:94515470-94515492 TATCTCAATCTATTCAGAAAAGG + Intergenic
1012126787 6:95439449-95439471 TATCTCAATAAATTCAGAAAAGG + Intergenic
1013867274 6:114713563-114713585 TCTCTCAGTCAGTGGAGACAGGG + Intergenic
1014563611 6:122920761-122920783 CATTTCAATCATTTAAGAAACGG - Intergenic
1015341525 6:132106267-132106289 TATCTCTGTAAGTTAAGAGATGG - Intergenic
1015803560 6:137085984-137086006 TTTCTCAGTCAGTTCAAAAGTGG + Intergenic
1016486855 6:144550045-144550067 CATCTTAGTCATTTCAGAAAGGG - Intronic
1016731781 6:147435341-147435363 TAACTCAGTCAGTTCAGACTGGG + Intergenic
1016763854 6:147770463-147770485 TAACTCAGTCAGTCAATGAATGG - Intergenic
1017444043 6:154491197-154491219 TATCTCATGCAGTTATGAATGGG - Intronic
1018534053 6:164800184-164800206 TAGCTCAGGCAGCTAAGAATTGG + Intergenic
1018584587 6:165342832-165342854 TAGATAAGTCAGTCAAGAAAAGG + Intronic
1019336133 7:483765-483787 TTTCTCAGACAGTGAAGACAAGG + Intergenic
1020568574 7:9827355-9827377 TATCTCAGTAAATGCAGAAAAGG - Intergenic
1022817467 7:33927558-33927580 TATTGCAGTAAGTCAAGAAAGGG + Intronic
1027287967 7:76669779-76669801 TATCTCAATAACTGAAGAAAGGG + Intergenic
1028356213 7:89913176-89913198 TAGATAGGTCAGTTAAGAAAAGG + Intergenic
1031474724 7:122207514-122207536 TAGCTCAGGAAGTTAAAAAAAGG - Intergenic
1031556523 7:123183322-123183344 TATCTCAGTTTGTTAAGAGAAGG - Intronic
1033007922 7:137587372-137587394 TATCACAGGCAGTTACAAAATGG + Intronic
1033713142 7:143970144-143970166 TATATCCATCAGTAAAGAAATGG - Intergenic
1033956829 7:146859811-146859833 TATCTCAGTGAGTAAATAGAAGG + Intronic
1034330104 7:150275283-150275305 AATTTCAGTCGCTTAAGAAAGGG + Intronic
1035871255 8:3138248-3138270 TATCTCAGTGACTTAAAATAAGG + Intronic
1036295224 8:7529281-7529303 TATTTCTGTGAGTTGAGAAATGG + Intergenic
1036327346 8:7791737-7791759 TATTTCTGTGAGTTGAGAAATGG - Intergenic
1038414821 8:27387224-27387246 TATCTCTGCCACTGAAGAAAGGG + Intronic
1039122708 8:34166299-34166321 TAACTCAGTCAGGTAATCAAGGG - Intergenic
1039688189 8:39831260-39831282 TATCTCAGGCAGATGTGAAATGG + Intronic
1040042455 8:42930328-42930350 TCTGTCAGTCAGTTAATAGATGG + Intronic
1041130507 8:54694052-54694074 TATCTCAGTAAATGCAGAAAAGG - Intergenic
1041506290 8:58601648-58601670 TTTCTCTGTTAGATAAGAAAAGG + Intronic
1042194210 8:66218561-66218583 GATTTCATTCAATTAAGAAAAGG + Intergenic
1042507206 8:69573273-69573295 CAGCTCAGTTAGTTAAGAAAAGG + Intronic
1042940804 8:74105884-74105906 TATCTCCTTCAGTTAAGACTAGG + Intergenic
1043618493 8:82158437-82158459 TATCTAAGTCACATGAGAAAGGG + Intergenic
1043668920 8:82856247-82856269 TATTTTAGTCTGTTAAGAAAAGG - Intergenic
1044546917 8:93470228-93470250 TATCTCAGTAATTGCAGAAAAGG + Intergenic
1044577881 8:93791268-93791290 TTTCTCAGTCACATATGAAATGG + Exonic
1046334166 8:112761233-112761255 TATCTCTATCATTTAAAAAAAGG + Intronic
1046641975 8:116741994-116742016 TGACTCAGCCAGTTATGAAATGG - Intronic
1048630025 8:136232641-136232663 TATCTCAATCAATGCAGAAAAGG - Intergenic
1049157946 8:141078370-141078392 GATGTCATTCAGTTAAGAAGAGG - Intergenic
1050241227 9:3637704-3637726 TTTTTCATTCAGTTAAGTAAAGG - Intergenic
1050838038 9:10109300-10109322 TGTTACAGTCAGTAAAGAAACGG + Intronic
1051411135 9:16790711-16790733 TATCAAAGTCAGTTATGAAGTGG - Intronic
1051933500 9:22414961-22414983 TATCTAGGACAGTTAAGGAAGGG - Intergenic
1052246114 9:26337389-26337411 CATCACAGTGAGTTAAGGAAGGG + Intergenic
1052369650 9:27649374-27649396 TATCTCAGTAAATGCAGAAAAGG + Intergenic
1052521707 9:29556493-29556515 GATGTGAGTCAGATAAGAAATGG + Intergenic
1052590209 9:30482321-30482343 TATCTCAGTTAATGCAGAAAAGG + Intergenic
1055035446 9:71813405-71813427 AAGATCACTCAGTTAAGAAATGG - Intronic
1055387952 9:75784566-75784588 CATCTCAATCAATAAAGAAAAGG - Intergenic
1055802521 9:80055367-80055389 TATCTCAGTAAATACAGAAAGGG + Intergenic
1056666513 9:88585079-88585101 TTTCTAAGTCAGTTCAGAAATGG + Intergenic
1057365740 9:94419015-94419037 TAACTCACTCAGGTAAAAAAGGG - Intronic
1057657592 9:96969063-96969085 TAACTCACTCAGGTAAAAAAAGG + Intronic
1059182435 9:112229860-112229882 TTTCTCACTCATTTAAAAAATGG - Intronic
1060144400 9:121239023-121239045 TGTCCCAGTCAGTTCAGAGATGG + Intronic
1060472741 9:123962167-123962189 TAGCTCCGTGAGTTAGGAAATGG + Intergenic
1060863089 9:126972410-126972432 TAAATTATTCAGTTAAGAAAAGG + Intronic
1188690183 X:33119888-33119910 TAGCCCAGTAAGTGAAGAAAAGG - Intronic
1188926236 X:36048133-36048155 TATCTCAATGAGATCAGAAATGG - Intronic
1188964452 X:36534240-36534262 TATGACAGTCAGTGAAGAATTGG - Intergenic
1189467982 X:41292185-41292207 TAACTAAATCAATTAAGAAATGG + Intergenic
1189731113 X:44022139-44022161 AATCTCAGTCAGTTTCCAAAGGG - Intergenic
1191703470 X:64067763-64067785 TATCTCAGTAGGTGCAGAAAAGG - Intergenic
1191885788 X:65886628-65886650 TATCTCATTCTGATATGAAAGGG - Intergenic
1193808957 X:86028424-86028446 TATGTCAGCTAGTTTAGAAAGGG + Intronic
1194489975 X:94533804-94533826 TATCTCAGTAGATGAAGAAAAGG + Intergenic
1194556193 X:95363360-95363382 AATCACAGTCAGTAAAAAAATGG - Intergenic
1196177537 X:112656270-112656292 TATCTCAGTAAATGAAGAAAAGG + Intronic
1196484776 X:116193241-116193263 TATCTCAGTTGGTTAATAAAAGG + Intergenic
1199364549 X:146964798-146964820 TATCTGAGTCTGCAAAGAAATGG + Intergenic
1200821140 Y:7583621-7583643 TATATCAGTCACTTGAGAAATGG + Intergenic
1200876202 Y:8157189-8157211 TATATCAGTCACTTGAAAAATGG + Intergenic
1200883907 Y:8250610-8250632 TATGTCAGTCAATAAAGCAAAGG + Intergenic
1201057410 Y:10009605-10009627 TATATCAGTCACTTGAAAAATGG - Intergenic
1201751924 Y:17441920-17441942 TATCTCAATAAATGAAGAAAAGG - Intergenic
1201993080 Y:20050641-20050663 TATCTCAGTCATTTATGAATAGG - Intergenic
1202239162 Y:22749121-22749143 TATATCAGTCACTTGAGAAATGG - Intergenic
1202302409 Y:23430931-23430953 CATATCAGTCAGTTAAGCAGGGG + Intergenic
1202392150 Y:24382888-24382910 TATATCAGTCACTTGAGAAATGG - Intergenic
1202478634 Y:25287229-25287251 TATATCAGTCACTTGAGAAATGG + Intergenic
1202568402 Y:26239663-26239685 CATATCAGTCAGTTAAGCAGGGG - Intergenic