ID: 1078287381

View in Genome Browser
Species Human (GRCh38)
Location 11:9970822-9970844
Sequence TTCCCTGTCTTTGCTAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078287381 Original CRISPR TTCCCTGTCTTTGCTAGATA TGG (reversed) Intronic
903009030 1:20317520-20317542 GTGCCTGTCTTTGCTGGAAAAGG - Exonic
903095603 1:20970266-20970288 TTTCCAGTCTTTGCTGGAAAAGG - Intronic
904030246 1:27528964-27528986 TTCCCTGTCCTTGCCAGGTGGGG - Intergenic
904228620 1:29047161-29047183 TTCAGTGTCTTTATTAGATAAGG + Intronic
906335482 1:44926428-44926450 TTCCCTGTCTTTTCTTGCCAAGG - Intronic
906972998 1:50537353-50537375 TTCTCTGTCTTTGATCAATAAGG - Intronic
907050454 1:51326614-51326636 TTATCTGTCTTTGATAGATATGG + Intronic
907995918 1:59632568-59632590 TTCCCTTTCTTTGCTTGAGGGGG - Intronic
909503153 1:76357890-76357912 TTCCCTGTCTTTGACTGATTAGG - Intronic
909809955 1:79921117-79921139 TTCCCTTTCTTTGCCAGGAAAGG + Intergenic
910708397 1:90154046-90154068 TTCTTTGTCTTTGATAGATTGGG + Intergenic
915447082 1:155979909-155979931 TTCCTGGTCTTTGCTATTTAAGG - Intronic
916023508 1:160814549-160814571 TTCCCTCTCTTTGCTAATGATGG - Exonic
916331565 1:163623855-163623877 TTTTCTGTCTTTGTTAGATTGGG + Intergenic
916678399 1:167083252-167083274 TTTCCTGGGTTTGATAGATAAGG - Intronic
917677171 1:177330746-177330768 TTCTTTTTGTTTGCTAGATATGG - Intergenic
920300936 1:204988527-204988549 TTTCCTGACTTTGCTGGAAAGGG - Intronic
1064908009 10:20369217-20369239 TTCCTTGTCTTTGTTGGATTGGG + Intergenic
1065001129 10:21338556-21338578 TTCCATGTTTTTGGTAGATTTGG + Intergenic
1065135629 10:22666414-22666436 TTCCTTTTCTTTGGTAGATTGGG - Intronic
1065174722 10:23065219-23065241 TTCCTTTCCTTTGCTGGATATGG - Intergenic
1065305491 10:24364653-24364675 TTTCCTGCCTTTGCTAACTAAGG - Intronic
1065516536 10:26529578-26529600 TGCTCTGTCTTTCCCAGATAAGG + Intronic
1066049435 10:31620461-31620483 TTTCCTGTGTTTGCTTCATAGGG - Intergenic
1068493928 10:57760352-57760374 TTCAGTGTCTTTTCTAGTTAAGG + Intergenic
1068761384 10:60714220-60714242 TTCAATGTCTTTAATAGATAAGG - Intronic
1069643605 10:69974005-69974027 TTTCCTGTCTTTCCAAGATTTGG - Intergenic
1071024062 10:81091938-81091960 TTCTCTGTCTTTGTTGGATTGGG + Intergenic
1072540286 10:96393347-96393369 TTCATTGTCTTTGCTAGGGAAGG - Intronic
1073700993 10:105926386-105926408 TTCCTTGTTTTTGCTGGATTGGG - Intergenic
1075754279 10:124798714-124798736 ATCCCTGTCTTTGCTAGGTGTGG + Intergenic
1077734248 11:4771994-4772016 TTCTCTGTCTTTGCTAGATGAGG + Intronic
1078287381 11:9970822-9970844 TTCCCTGTCTTTGCTAGATATGG - Intronic
1078588118 11:12611627-12611649 TTCTCTGTCTTTGTCAGATTGGG - Intergenic
1079197561 11:18343542-18343564 TTCCATTGCTTTACTAGATATGG + Intronic
1079859403 11:25648315-25648337 TGGCTTGTCTTTGCTAGATTGGG + Intergenic
1081437543 11:43043331-43043353 TTCCCTTTCTTTGTTTTATAAGG - Intergenic
1082259274 11:50065006-50065028 CTCCCTATCTTTGCCAGATATGG - Intergenic
1082797693 11:57389825-57389847 TTCCCTTTCTATGGTAGATGGGG - Intronic
1085444869 11:76593803-76593825 TTGCCTGTTTTTGGTGGATAGGG - Intergenic
1086242248 11:84709193-84709215 TGCCATCACTTTGCTAGATAAGG - Intronic
1086957944 11:92953367-92953389 TTTTCTCTCTTTGGTAGATATGG - Intergenic
1088656813 11:112007434-112007456 TTCTCTGTATTTCCTAGATTTGG - Intronic
1089220278 11:116864947-116864969 TACCCTGTCTTTGCTAATGATGG + Intronic
1089682962 11:120129722-120129744 TTCCCTGGCTTTCCTGGAAAAGG + Intronic
1090021085 11:123129148-123129170 TTTTGTGTCTTTGCTAGAGATGG - Intronic
1090288809 11:125523770-125523792 TTCCCTTTCAATGTTAGATATGG + Intergenic
1090863047 11:130671738-130671760 TTCCATGTCTCTGCTATCTATGG + Intergenic
1091136644 11:133196950-133196972 CACCCTGTCTTTACTAGAAAAGG - Intronic
1093389726 12:18603304-18603326 TTCTTTGTCTTTGTTAGACAAGG - Intronic
1093991548 12:25594001-25594023 TTCTTTGTCTTTGTTAGATTGGG - Intronic
1095225940 12:39676382-39676404 TTCTTTGTCTTTGCTGGATTGGG - Intronic
1096027287 12:48377658-48377680 TTCGCTGGCTCTGCTAGATGAGG + Intergenic
1096420068 12:51449416-51449438 TTTCCTTTCTTTTTTAGATAGGG - Intronic
1096875685 12:54628653-54628675 TTCCATGGCTCTGCTAGATGGGG - Intergenic
1098473337 12:70870547-70870569 TTCACTGTCTTTGGGAGATTAGG - Intronic
1098967384 12:76805300-76805322 TTTTCTTTCTTTTCTAGATATGG + Exonic
1099719573 12:86342943-86342965 ATGACTGTCTTTACTAGATAGGG + Intronic
1101474237 12:105028976-105028998 TTTCCCGTCTATGCTAGAAACGG + Intronic
1102131243 12:110530402-110530424 ATCCCTGTCTTTGCTGGTGATGG - Intronic
1105908388 13:24836087-24836109 TTCCTTGTCTTTGTTGGATTAGG - Intronic
1108089425 13:46831637-46831659 TTCACTGTATTTGTTACATATGG + Exonic
1109135244 13:58641308-58641330 TTTCCTGTCATTGCCAAATAGGG - Intergenic
1110181963 13:72627423-72627445 TTCTCTGTCTTTGATGGATTGGG - Intergenic
1110627697 13:77669496-77669518 TTCCTTGTCTTTGTTGGATTGGG - Intergenic
1111464690 13:88593690-88593712 TTCCCTGACTGTGCTAGGGAGGG + Intergenic
1111909250 13:94292133-94292155 TTTTCTGTCTTTGCGAAATAGGG - Intronic
1112738212 13:102444429-102444451 TTCTCTGTCTTTGTTGGATTAGG - Intergenic
1115207337 14:30923499-30923521 TTTTCTGTCTTTTCTATATATGG - Intronic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1121848316 14:97195437-97195459 TTCTTTGTCTTTGATAGATTGGG + Intergenic
1123948161 15:25248844-25248866 TTCCCTGTCTTTCCAAGGTTTGG + Intergenic
1126154833 15:45556201-45556223 TTCCCTGACTTTGATACACATGG + Intergenic
1130126361 15:81097276-81097298 TTCCTTTTCTTTTCTAGAGATGG + Intronic
1130925255 15:88380755-88380777 GTCCCTGTCTTTCCTATTTAAGG - Intergenic
1131721472 15:95173015-95173037 TTCCCTGCCTTTGGGAGATGGGG - Intergenic
1132044659 15:98553486-98553508 CTCAGTGTGTTTGCTAGATAAGG - Intergenic
1133563832 16:6974200-6974222 TTCCATGTCTTTGCTTAATGGGG + Intronic
1135355026 16:21761940-21761962 TTCCCTGTTTTTGGTGGAGATGG + Intergenic
1135453510 16:22578082-22578104 TTCCCTGTTTTTGGTGGAGATGG + Intergenic
1139240540 16:65387561-65387583 TTCCTTTTCTTTGCTAGAGATGG + Intergenic
1141201901 16:81904616-81904638 TTCCCTCTGTGTGCTAGAGAAGG + Intronic
1141910522 16:87055507-87055529 TTCCCTTTCTCTGCCAGAAAAGG - Intergenic
1142474926 17:183004-183026 TTACCTGTCTGTGCTGGATGGGG - Intergenic
1143323638 17:6084126-6084148 AACCCTCTCTTTGCTGGATAAGG - Intronic
1143402357 17:6654915-6654937 TTCGCTGTCTTTGCCTGTTATGG - Intergenic
1144345088 17:14342133-14342155 TTCCGTATCGGTGCTAGATAGGG + Intronic
1148125155 17:45232821-45232843 TTCTCTCTCTCTCCTAGATATGG - Intronic
1149034748 17:52121095-52121117 TTCCATGTCTTTGCCATATGTGG + Intronic
1149485420 17:57038993-57039015 TTCCCTTTCTTTTTTTGATAGGG + Intergenic
1149896833 17:60434880-60434902 TTCCCTGGCTTTGATACACATGG - Intergenic
1149958343 17:61078666-61078688 TTCCCTGTCATTACTTGAGATGG + Intronic
1151262859 17:72930341-72930363 GAGCCTGTCTTTGCTAGTTATGG - Intronic
1151645892 17:75431342-75431364 TTCCCTGTCTTTTTTAGCTCTGG + Intergenic
1153636047 18:7114673-7114695 TTCTCTGGCTTTACTAGCTATGG - Intronic
1153725474 18:7950106-7950128 TTCCCTGCATTTGTTAAATATGG + Intronic
1157147236 18:45176320-45176342 TTCTGTTTCTTTGCTAGCTAAGG - Intergenic
1158834750 18:61319222-61319244 TTTACTGTCTGTGGTAGATATGG + Intergenic
1163290419 19:16376119-16376141 TTACCTGTCTTCCCTAGATAGGG - Intronic
1163311883 19:16519861-16519883 TATCCTGTCTCAGCTAGATAAGG + Intronic
1166620266 19:44291726-44291748 TTCTGTTTCTTTGGTAGATAAGG - Intronic
1167804148 19:51767979-51768001 TTCCCTGTCCCTGCTTGATGTGG - Intronic
925626510 2:5846733-5846755 TTCCTTCTCATTGCTAGAGATGG - Intergenic
925705658 2:6682496-6682518 TTCTTTGTCTTTGTTAGATTGGG - Intergenic
926121288 2:10242542-10242564 TTCCCTGTCTCTGCAGGATGCGG - Intergenic
926725973 2:15998233-15998255 TCCCCTGTCTCTGCTGGAGATGG - Intergenic
927462405 2:23310465-23310487 TCCCCTGTCTGTGTTAGGTATGG - Intergenic
927893479 2:26766769-26766791 GCCCCTGTCTTTGCCTGATAGGG - Intronic
928691538 2:33804653-33804675 TTACCTGTCATTGCTAGCTCTGG + Intergenic
931016643 2:57989007-57989029 TTCCCTCTGTTTGCTAGACTGGG - Intronic
932703675 2:74007369-74007391 TCCTCTGTCATTGCTAGATCCGG - Intronic
933405062 2:81847530-81847552 TTCCCATCCTTTGCCAGATAAGG + Intergenic
935307852 2:101755081-101755103 TTCACTTTGTTTGCTAGATTTGG + Intronic
936113243 2:109682379-109682401 TACTCTGTATTTGCTAGATGGGG + Intergenic
936344846 2:111667655-111667677 TTCCTTTTCCTTCCTAGATAGGG - Intergenic
937839502 2:126511320-126511342 TTCCCTGTTTTTGGTGGAGATGG + Intergenic
939149631 2:138457424-138457446 TTCTTTGTCTTTGTTAGATTGGG - Intergenic
940784851 2:157970681-157970703 TTCTTTGTCTTTGCTAGATTGGG + Intronic
941922176 2:170862335-170862357 TTCCCTACCTGTGCTAAATAGGG - Intergenic
942909070 2:181219859-181219881 TTTCCTTTCTTTTCTAGACAGGG - Intergenic
943167934 2:184355487-184355509 TTCTCTGTCTTTGCTCCTTATGG + Intergenic
945506350 2:210645773-210645795 ATACATGTATTTGCTAGATAAGG + Intronic
946381944 2:219354831-219354853 TGCCCAGTCTCTGCTAGAGATGG - Intergenic
947747558 2:232516816-232516838 TTCCCTGTCTCTTCTTGAAATGG + Intergenic
948833096 2:240609379-240609401 TTTCCGGTCTTTGTGAGATAAGG - Intronic
1169325804 20:4675124-4675146 TTCGCTGTCTTATCTGGATAAGG - Intergenic
1169334878 20:4748059-4748081 TTCCTTGTCTTTTGTAGAAATGG + Intergenic
1169429251 20:5521914-5521936 TTCCCTGTCTCTGCTAGATCTGG + Intergenic
1170950553 20:20932143-20932165 TTCCTTGGCATTGCTAGAGATGG + Intergenic
1171027909 20:21648940-21648962 TTCTCTGTCTTTGTTGGATTGGG - Intergenic
1171399537 20:24863609-24863631 ATCCCTGTCACTGCTTGATATGG + Intergenic
1171934504 20:31260962-31260984 TTCCATGTCTTTGCTCTCTAAGG - Intergenic
1177219414 21:18172034-18172056 TTCCATGTCTTTCCTAGGCAGGG + Intronic
1183132720 22:35854941-35854963 TTCTCTCTCTTTTCTTGATATGG + Intronic
951885195 3:27517436-27517458 TTCCTTGTGTTTGCTTGATTTGG + Intergenic
952222839 3:31341942-31341964 ATCTTTGTCTTTACTAGATAGGG - Intergenic
953062523 3:39439062-39439084 TTCACTTTATTTGCAAGATAAGG + Intergenic
953062861 3:39442132-39442154 TTCACTGTATTTGCAAAATAAGG + Intergenic
953856466 3:46503063-46503085 TGCCCTGGCTTTGCCAGATAAGG + Intergenic
954416039 3:50393829-50393851 TTCCCTGTGTTCCCCAGATAAGG - Intronic
956481748 3:69679897-69679919 TTCCCAAACTGTGCTAGATAGGG - Intergenic
957217285 3:77336691-77336713 TTGCCTGTCTTTGCCATACAAGG - Intronic
957589537 3:82177696-82177718 ATCCCTGTTTTTGCTACATCAGG - Intergenic
958929728 3:100196279-100196301 TTTCATGTTTTTGATAGATATGG - Intergenic
959998209 3:112701150-112701172 TTCTTTGTCTTTGTTAGATTGGG - Intergenic
960193575 3:114737303-114737325 TTGCCTTTTTTTTCTAGATATGG + Intronic
962499592 3:135976710-135976732 TTCCCTATCTTTGCCTTATATGG + Intronic
962843412 3:139255133-139255155 TTCCCTGTCTCAGCTTGCTATGG + Intronic
963196727 3:142540111-142540133 CTCCCTGTCTTTTCTATAAATGG - Intronic
964403523 3:156324650-156324672 TTCCCAGGCTTTGCTAGTTTGGG + Intronic
964970872 3:162558660-162558682 TACTCTGTCTTTGCTATATGGGG + Intergenic
965408484 3:168300845-168300867 TACCCTCTCTGTGCTAGATGTGG + Intergenic
967958568 3:194899882-194899904 TTCCTTGTCTTTGTCAGATTGGG + Intergenic
970106089 4:12586323-12586345 TTACATGTCTTTGCCAGTTATGG - Intergenic
970549174 4:17162626-17162648 TTCCTTGTTTTTGTTAGATTGGG + Intergenic
971050289 4:22854512-22854534 TTCTTTGTCTTTGATAGATTGGG + Intergenic
973656895 4:53057230-53057252 TTCCATGTCTTTGCTAGTACGGG - Intronic
973831386 4:54763546-54763568 TTCTTTGTCTTTGTTAGATTGGG + Intergenic
974165186 4:58192148-58192170 TTCTCTGTCTTTGTTGGATCGGG - Intergenic
979097205 4:116565793-116565815 TTTCTTGTCTTTGCTAGTTTTGG - Intergenic
980409837 4:132402931-132402953 TTCTCTGTCTTTGACAGATTGGG + Intergenic
983524531 4:168747572-168747594 TTCCCTGCCTTCTCTACATATGG - Intronic
989477193 5:41888160-41888182 TTACATGTGTTTCCTAGATAAGG + Intergenic
989526556 5:42460110-42460132 TTCTCTCTCTTTGCTATATGAGG + Intronic
991128777 5:63097427-63097449 AAGCCTGTCTTTGTTAGATAAGG - Intergenic
991171615 5:63633137-63633159 TTCCCTGTCTTACATGGATATGG + Intergenic
991630829 5:68655056-68655078 GCCCCTGTCTTTGCTAGGTGGGG + Intergenic
992009276 5:72510592-72510614 TTCGCTCTCATTGCTGGATAGGG + Intergenic
992668306 5:79033403-79033425 ATCCCTGTATTTGAAAGATATGG - Exonic
993121238 5:83776823-83776845 CTTCCTGTCTTTGCTATATTTGG + Intergenic
993752199 5:91683807-91683829 TTCCCTGGCTTTGCTTGTTTAGG - Intergenic
993883755 5:93393801-93393823 TTCTTTGTCTTTGTTAGATGGGG + Intergenic
995845670 5:116491196-116491218 TTCCCTTTCTTTTCTATATGTGG + Intronic
996467822 5:123823876-123823898 TTTCCTGTGTTGGTTAGATAGGG - Intergenic
997043438 5:130285198-130285220 TTCCATGTCTTTGCTAAATTTGG - Intergenic
997273480 5:132562312-132562334 TGCCCTATCTTTGCTACCTACGG - Intronic
998947301 5:147353402-147353424 CTTCCTGTTTTTGCTGGATAAGG - Intronic
1000511489 5:162189230-162189252 TTCTTTGTCTTTGTTAGATTGGG + Intergenic
1000525528 5:162352910-162352932 TTCTCTGTCTTTGTTGGATAGGG + Intergenic
1000545299 5:162592736-162592758 TTCCCTTCCTCTGCTGGATATGG + Intergenic
1003520368 6:6853526-6853548 ATCCCTGTCTTGGCTAGGCACGG + Intergenic
1004888666 6:20075874-20075896 TTCCTTGTCTTTAATAGATTGGG - Intergenic
1005072629 6:21875605-21875627 TTCTTTGTCTTTGTTAGATTGGG - Intergenic
1005276242 6:24221612-24221634 TTCCCTGTCCTAGCTCCATATGG - Intronic
1005410092 6:25535474-25535496 TACCCTGTCATTCCTAGATAAGG - Intronic
1009672222 6:66770773-66770795 TACCCTCTCTCTGCTAAATAAGG + Intergenic
1010196990 6:73249645-73249667 TTGCCTGTCTCTGCTGGATGTGG + Intronic
1012543490 6:100390747-100390769 TTCCCTCTCTCTGCTGGATATGG + Exonic
1013330648 6:109096404-109096426 TTCCCTGACTTTCCAAGATTGGG - Intronic
1013852510 6:114533655-114533677 TTCTTTGTCTTTGTTAGATTGGG + Intergenic
1014946828 6:127508548-127508570 TTCCCAGTCTTTGCTCCAGAGGG - Intronic
1014995842 6:128143295-128143317 TTCCCTTCCTTTTCTATATATGG - Intronic
1016759355 6:147720129-147720151 TTCCCCCTCTTACCTAGATAGGG - Intronic
1017943430 6:159073937-159073959 TTCTCTATATTTGCTAGATCAGG + Intergenic
1020095270 7:5365118-5365140 TTTCCTGTCTTTTCAAGATAGGG + Intronic
1021481125 7:21118371-21118393 TTCCTTGTCTTTGTTGGATTGGG + Intergenic
1022738604 7:33099689-33099711 TCCCCAGTCATTGCTATATAAGG - Intronic
1023191217 7:37585087-37585109 TTCCCTGGAATTGCTAAATAGGG + Intergenic
1023345809 7:39270087-39270109 CTCCCTGTCTTTGAGAGACAGGG + Intronic
1027453994 7:78364617-78364639 TTCTCTGTCTCTGCCAGAGAAGG + Intronic
1028284091 7:88972992-88973014 TTCACTGTCTTTGGAAAATATGG - Intronic
1030045067 7:105487730-105487752 TTCCCTGGCTTTGTTAATTAAGG - Intronic
1030423973 7:109348068-109348090 TTCTCTGTCTTCTCTAGTTATGG - Intergenic
1030557603 7:111046727-111046749 TTCCCTTTCTTTGGTATATATGG - Intronic
1031037272 7:116801351-116801373 TTCCAATTCTTTGATAGATAAGG - Intergenic
1039149410 8:34486915-34486937 TTACCTGGCTTTGCTATAAAAGG + Intergenic
1041352613 8:56963800-56963822 TGTCCTGTCTTTTCTAGATCTGG + Exonic
1041502611 8:58554705-58554727 TTCCCTGTTTTTGCCAGATTTGG + Intronic
1041825593 8:62093276-62093298 TTCTCTGTCTTTCCTAGTTATGG + Intergenic
1042976432 8:74475308-74475330 TTCCTTGTCTCTGCTAGCTTTGG + Intronic
1043416896 8:80060524-80060546 TTCTCTGGCTTTGGTAAATAGGG - Intronic
1046499371 8:115055933-115055955 TTCCCTGTCTTTGTTACACCCGG - Intergenic
1047387363 8:124422429-124422451 TGCCCTGCCTTTGGCAGATATGG - Intergenic
1047799251 8:128291909-128291931 TTCCCAGACTTTGCTATACAGGG + Intergenic
1048413519 8:134200523-134200545 TTCCCTGTCTCTCCCTGATAAGG - Intergenic
1048909857 8:139124924-139124946 TTCCTAGTCTTTCCTGGATACGG + Intergenic
1050620032 9:7442579-7442601 TTCCCTGACTGTGTTAGTTAGGG + Intergenic
1050762102 9:9084947-9084969 TTCCCTGTCTGTGCTAAAAATGG - Intronic
1051214874 9:14786294-14786316 TTCCCTGTCTTTAATACCTAGGG + Intronic
1053355398 9:37441385-37441407 TACCCTGTCTGTGCTAGACTGGG + Exonic
1055603887 9:77948410-77948432 CTCCCTTTCTTTGCTGGAAAAGG - Intronic
1055846663 9:80573013-80573035 TTCCTTGTCTTTGTTGGATTGGG - Intergenic
1055905674 9:81291485-81291507 TTCCTTGTCTTTGTTGGATTGGG + Intergenic
1056222728 9:84466066-84466088 TTGCCTGTCTTGGCCATATATGG - Intergenic
1056309575 9:85325438-85325460 TTCCTTGTCTTTGTCAGATTGGG - Intergenic
1057784581 9:98076990-98077012 TTGGCTGTCTTTTCCAGATAAGG - Exonic
1059123098 9:111660335-111660357 TTTCCTGGGTTTGCTAGATGGGG + Intronic
1060373217 9:123094792-123094814 TTCTTTTTCTTTTCTAGATATGG + Intronic
1062702105 9:137912678-137912700 TTCCCTGTCTTCCTGAGATAAGG + Intronic
1185468719 X:370200-370222 TTCTCCCTCTTTGCTAGAGAGGG - Intronic
1186974417 X:14885682-14885704 TTACATTTCTTTGCTAGATTAGG - Intronic
1187647603 X:21365534-21365556 TTCCATGTCTTTGCTGTGTATGG + Intergenic
1188427676 X:30067795-30067817 TTCCCTGTCTTTCCTTGACTGGG - Intergenic
1191080764 X:56507038-56507060 TTCTTTGTCTTTGCTGGATTGGG - Intergenic
1191125144 X:56946565-56946587 TTGCCTGTCTTTATTTGATATGG - Intergenic
1192905115 X:75543219-75543241 TTCTTTGTCTTTGATAGATTGGG + Intergenic
1192913514 X:75631102-75631124 TTCCTTGTCTTTGTTGGATTGGG + Intergenic
1195019382 X:100811739-100811761 TTCTTTGTCTTTGCTGGATGGGG + Intergenic
1195618677 X:106932391-106932413 TTCCCTGGCTTTTCTAGTTGAGG - Intronic
1196530757 X:116783506-116783528 TTCTTTGTCTTTGTTAGATTGGG - Intergenic
1196619902 X:117809451-117809473 TTCCTTGTCTTTGTTGGATTGGG - Intergenic
1197317698 X:124988392-124988414 TTCAATGTCTTTAATAGATACGG - Intergenic
1200830517 Y:7684850-7684872 AACACTGTCTTTGCTAGATAAGG + Intergenic