ID: 1078290525

View in Genome Browser
Species Human (GRCh38)
Location 11:10006160-10006182
Sequence CTGACTTGCCTCGAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078290525 Original CRISPR CTGACTTGCCTCGAGGTGGA CGG (reversed) Intronic
902112494 1:14094097-14094119 CTGACTTGCCTTGGGGAAGAGGG + Intergenic
902814226 1:18907047-18907069 CTGCCTTGCCTGGAGGCAGAAGG - Exonic
906207720 1:43996043-43996065 CCGACTGGCCTCGAGGTCGAAGG - Exonic
908644140 1:66258962-66258984 CTGAAATGCCTCAAGCTGGAGGG - Intronic
911378095 1:97076385-97076407 CTGACCTCCCTCGAGCAGGAAGG - Intergenic
915595987 1:156896770-156896792 CTGAGTCACCTGGAGGTGGAGGG - Intronic
923091586 1:230745166-230745188 CTGACTTGCCTCAACTTGCAAGG - Intergenic
1063361895 10:5466306-5466328 CAGACTTGCCTGGGGGAGGAGGG - Intergenic
1065444327 10:25781916-25781938 ATGACTTGCCTTGAGGAAGAAGG + Intergenic
1065864941 10:29906406-29906428 CTGACTTGCCTTGGGGAAGAGGG + Intergenic
1067682868 10:48451304-48451326 CTGTCCTGCCTGGAGTTGGAGGG - Intronic
1071307795 10:84314397-84314419 CTGAGTTGCCTCTTGGTGCAGGG - Intergenic
1072712207 10:97723163-97723185 ATAACTTGCCTCTAGCTGGAGGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075586454 10:123661950-123661972 CTGACTTCCCTCCAGCTTGAAGG + Intergenic
1075823789 10:125336448-125336470 CTGACTTGCCTCCAAGTGTCTGG - Intergenic
1076445171 10:130509425-130509447 CTGACAGGGCCCGAGGTGGAGGG + Intergenic
1076688601 10:132209321-132209343 CTCCCTTGCCTCTGGGTGGATGG + Intronic
1078106199 11:8359598-8359620 GTCACTTGCCTCCAGGTGGTGGG + Intergenic
1078195379 11:9132876-9132898 TTGACTTGCCACCAGGTGGCTGG - Intronic
1078290525 11:10006160-10006182 CTGACTTGCCTCGAGGTGGACGG - Intronic
1079103239 11:17554491-17554513 GAGACTTTCCTCCAGGTGGAGGG - Intronic
1085077776 11:73606995-73607017 CTGAGTTTCCTCCAGCTGGAAGG + Intergenic
1086074305 11:82834079-82834101 CTTACATGGCTGGAGGTGGAAGG - Intronic
1088848027 11:113683795-113683817 CGAACCTGCCTAGAGGTGGAGGG + Intergenic
1089321333 11:117628662-117628684 CTGACTTGCATTGTGGTGAAGGG + Intronic
1089806658 11:121096746-121096768 CAGTCTTGCCTCGAGAAGGATGG + Intergenic
1094553983 12:31479760-31479782 GTGACCTCCCTGGAGGTGGAAGG + Exonic
1096660469 12:53121038-53121060 CTGGCTTGTCAGGAGGTGGAGGG - Intronic
1107814850 13:44235242-44235264 CTGACTTGACATGAGGTGGTGGG + Intergenic
1110995702 13:82106396-82106418 GTGTCTTGCCTTGAGGTTGATGG + Intergenic
1117462934 14:55964232-55964254 TTGTCTTGCCTGGAGGCGGACGG - Intergenic
1119484007 14:74976745-74976767 CTCACTTCCCTGGAGGTTGAGGG - Intergenic
1121616892 14:95319572-95319594 GTCACTTGCCTCGAGGTGGGAGG - Intronic
1121927011 14:97936670-97936692 CTGATGTGCCTTGATGTGGATGG + Intronic
1123096648 14:105770062-105770084 CTGTCCTGCCTTGAGCTGGAGGG + Intergenic
1125673555 15:41490414-41490436 CTGACTAGTATGGAGGTGGAAGG - Intergenic
1133538265 16:6722935-6722957 CTGACTTGCCTAGAAGCAGAGGG - Intronic
1136104321 16:28018685-28018707 CTAACTTGCCTGGGGGTGGGGGG - Intronic
1143330309 17:6130070-6130092 CTTTTTTGCCTCGAGGTAGATGG + Intergenic
1144733855 17:17543936-17543958 GTGACTTGCCTCCATGTGGGAGG + Intronic
1146722070 17:35130602-35130624 CTGAGATGCCTCCAGGTGAATGG - Exonic
1148094090 17:45040490-45040512 CTGGCTTGGCTGGAGGCGGAAGG + Intronic
1148750731 17:49944468-49944490 CTGAGGAGCCTGGAGGTGGAGGG - Intergenic
1152940790 17:83172157-83172179 CAGACTAGCCTGGAGTTGGATGG + Intergenic
1153292431 18:3514809-3514831 GGGTCTTGCCTCGATGTGGATGG + Intronic
1159781268 18:72663371-72663393 CTGACTGTCCATGAGGTGGAAGG + Intergenic
1160586073 18:79914433-79914455 CTGACCTGCCTCCAGATGGGGGG + Intronic
1166855175 19:45779733-45779755 CTGACTTGACTCGTGGTGGGCGG - Intronic
1167281606 19:48572543-48572565 CTGACCTGTGTCGAGGTGGAAGG + Intronic
1167874192 19:52398008-52398030 CTGAATTTACTCGGGGTGGAGGG - Intronic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
925857873 2:8148127-8148149 CTGACGTGCCCCGAGGAAGAGGG - Intergenic
929584098 2:43102524-43102546 CTGACTTGCCTGGAGGAGCCAGG - Intergenic
929967773 2:46548426-46548448 ATGACTTGCCTGGAGGTGGGAGG - Intronic
931263049 2:60637143-60637165 CTGACTGGCCTGGAGCTGGGTGG + Intergenic
937461839 2:122095949-122095971 CTGCCTTACCTCCAGGAGGAAGG + Intergenic
947754024 2:232548150-232548172 GGGTCTTGCCTCGAGGTTGATGG + Exonic
1170174214 20:13450241-13450263 CGGTCTTGCCTCGATGTTGAAGG + Intronic
1172530846 20:35630406-35630428 CAGACCTGCCTCAGGGTGGATGG + Intronic
1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG + Intergenic
1176425208 21:6544384-6544406 CTGTCTTGGATCGAGGTGGTGGG + Intergenic
1178324109 21:31629507-31629529 GTTACTTGCCTTGAGTTGGAGGG + Intergenic
1178815055 21:35921803-35921825 CTGAGTTGGCACGGGGTGGAGGG - Intronic
1179700699 21:43152701-43152723 CTGTCTTGGATCGAGGTGGTGGG + Intergenic
1180847746 22:18993531-18993553 CTGACGTCCCTCGTGGTGAAAGG - Intergenic
1183952124 22:41357844-41357866 CTGATTTGCCCCCAGGGGGAGGG - Exonic
1184470203 22:44691877-44691899 CTGGCTTCCCTCGTGGAGGAGGG - Intronic
949346635 3:3083108-3083130 GTGACTTGCCTCCAGTTGGAGGG + Intronic
954576892 3:51681230-51681252 CTGCCTTTTCTCCAGGTGGAGGG + Intronic
956313404 3:67907241-67907263 CTGACTTTCTACCAGGTGGAAGG - Intergenic
957783054 3:84844632-84844654 GTGTCTTGCCTCCAAGTGGATGG - Intergenic
960719330 3:120610432-120610454 CTGAATTTCCTGGAGCTGGATGG + Intergenic
961466949 3:127087851-127087873 CTGGCTTGGCCAGAGGTGGAAGG + Intergenic
963436222 3:145270248-145270270 GTGACTTGCATCCTGGTGGAAGG + Intergenic
963846138 3:150159834-150159856 CTGCCTTCCCTGGGGGTGGAAGG - Intergenic
963859794 3:150297374-150297396 TTGAGTTGGCTGGAGGTGGAAGG + Intergenic
966537673 3:181052454-181052476 CTGACATCCCTCCAGCTGGAGGG - Intergenic
967863714 3:194173067-194173089 CTGACATTCCTGGGGGTGGAGGG + Intergenic
973128293 4:46616710-46616732 ATGACTTGCCTCAATGTTGATGG - Intergenic
975201375 4:71593816-71593838 CTCACTTACCTCAAAGTGGAAGG + Intergenic
975592096 4:76010950-76010972 CTTCCTTGCCTAGTGGTGGAAGG - Intergenic
976271717 4:83237337-83237359 CAGGCTTGCCTGGAGTTGGAGGG + Intergenic
976444217 4:85111228-85111250 CTGAGCTGCCTGGAGGTGAAGGG - Intergenic
977341610 4:95764870-95764892 CTGAGCTGCCTAGAGCTGGAAGG - Intergenic
977396968 4:96483642-96483664 CTGAGCTGCCTGGAGGTGGTTGG + Intergenic
980070684 4:128240550-128240572 CTGACTTGGCTGGAGGATGAAGG - Intergenic
983794702 4:171847379-171847401 GAGACTTGCCTCGATGTTGATGG + Intronic
985725692 5:1514803-1514825 CTGTTTTGGCTGGAGGTGGAAGG - Intronic
994174115 5:96692317-96692339 CTCCCTTGCCTCCAGGTGCAAGG - Intronic
999260730 5:150237325-150237347 CTGAGTTCCCTCGAGGTCAACGG + Intronic
1000156637 5:158558772-158558794 CTGACTGGCCTCCAGGGTGACGG + Intergenic
1001985602 5:176072636-176072658 CTGGCTGGCCTCGATGAGGACGG - Intronic
1002231270 5:177765488-177765510 CTGGCTGGCCTCGATGAGGACGG + Intronic
1002264068 5:178018260-178018282 CTGGCTGGCCTCGATGAGGACGG - Intronic
1002557445 5:180054356-180054378 GTGACATGCCACGGGGTGGAAGG - Intronic
1002856745 6:1044653-1044675 CTGCCTTGCCTCCATGTGGCGGG - Intergenic
1003651424 6:7964200-7964222 CTGAATTGCCTGGTGGTAGATGG - Intronic
1004569129 6:16828090-16828112 AGGTCTTGCCTCAAGGTGGATGG + Intergenic
1007089523 6:39173467-39173489 CTGCCTGGCCTGGAGGTGGGAGG + Intergenic
1008005133 6:46402435-46402457 CTGACTTGCCTTGGGGAAGAGGG - Intronic
1010211282 6:73364247-73364269 CCCACCTGCCTCGAGGTAGAGGG - Intergenic
1010383434 6:75250047-75250069 CTGGCTTACCTCAAGGTGGTTGG + Exonic
1011508004 6:88068592-88068614 CTGAATTGACCCGTGGTGGAAGG - Intergenic
1012119297 6:95343950-95343972 CAGTCTTGCCTCGATGTTGATGG + Intergenic
1012507601 6:99966534-99966556 CTGCCTTCCCTCCAGGTGTATGG + Intronic
1013210908 6:107985944-107985966 TTGAACTGCCGCGAGGTGGAAGG + Intergenic
1019884538 7:3892526-3892548 GTGACTTGCCAGGAGGTGAAGGG - Intronic
1021392769 7:20114592-20114614 CTGCCTTTCCTCTAGGGGGAAGG + Intergenic
1028661645 7:93283981-93284003 CTGTCTTGGCTGGAAGTGGAGGG + Intronic
1029846233 7:103414866-103414888 CTTACTTGACTACAGGTGGAGGG + Intronic
1033555337 7:142484093-142484115 ATGACTTGACTCTAGGTTGAAGG + Intergenic
1035337352 7:158138434-158138456 CTGAGTGGCCTGGAGCTGGACGG - Exonic
1036201349 8:6773773-6773795 CTGACTGGCCTCCAGGAGGTGGG - Intergenic
1038372042 8:27003906-27003928 CTAACCTGCCACCAGGTGGAGGG + Intergenic
1042165547 8:65942433-65942455 CTGGCCTGCCTCCATGTGGAGGG + Intergenic
1042548217 8:69970188-69970210 TTGCCTTGCCTTGATGTGGATGG - Intergenic
1046230026 8:111343069-111343091 CTGACCTCCCTCGAGGAAGAGGG + Intergenic
1054915564 9:70492499-70492521 CTGCACTGCCTAGAGGTGGAAGG - Intergenic
1056230462 9:84538303-84538325 CTGAGCTGCCTGGAGCTGGAGGG + Intergenic
1059361301 9:113743901-113743923 CTGACTTGATTCTAGGTGGTTGG - Intergenic
1060990226 9:127844839-127844861 CTCTCTTGCCTCAAGGTGGTGGG + Intronic
1061876791 9:133548037-133548059 CTGACTTTCCTGGAGGCCGAGGG + Intronic
1194210414 X:91063341-91063363 CTAACCTGCCACCAGGTGGATGG - Intergenic