ID: 1078295820

View in Genome Browser
Species Human (GRCh38)
Location 11:10069175-10069197
Sequence ATATTCTACTTTAAGTTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34981
Summary {0: 1, 1: 113, 2: 6246, 3: 19594, 4: 9027}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078295818_1078295820 8 Left 1078295818 11:10069144-10069166 CCACATAAAAATAACTAATTTTG 0: 1
1: 1
2: 1
3: 61
4: 614
Right 1078295820 11:10069175-10069197 ATATTCTACTTTAAGTTCTAGGG 0: 1
1: 113
2: 6246
3: 19594
4: 9027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078295820 Original CRISPR ATATTCTACTTTAAGTTCTA GGG Intronic
Too many off-targets to display for this crispr