ID: 1078307736

View in Genome Browser
Species Human (GRCh38)
Location 11:10207234-10207256
Sequence TTCCCACGAAACTACCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078307736 Original CRISPR TTCCCACGAAACTACCCTTA AGG Intronic
902381928 1:16056770-16056792 TTACCCAGAAACCACCCTTAGGG + Intronic
907258549 1:53198214-53198236 TTCTCACCAAACTGCCCTCAGGG + Intronic
910631031 1:89354487-89354509 TTCCCAGGATTCTTCCCTTAGGG - Intergenic
911749589 1:101481148-101481170 TTCCCATGATACTTCCCTTAGGG - Intergenic
911816060 1:102352884-102352906 TTCCCACGATTCTTCCCTGAGGG + Intergenic
913097904 1:115536885-115536907 TTCCCATGATTCTTCCCTTAGGG - Intergenic
915995327 1:160556713-160556735 TTCCCAGCTAACTACCCATAAGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
917098878 1:171426244-171426266 TTCCCAAGATTCTTCCCTTAGGG - Intergenic
918403414 1:184187709-184187731 TTCCCATGATTCTTCCCTTAGGG - Intergenic
923887972 1:238179518-238179540 TTCCCATGATTCTTCCCTTAGGG + Intergenic
924930842 1:248731103-248731125 TTCCCATGATTCTTCCCTTAGGG + Intronic
1068056728 10:52020638-52020660 TTCCCATGATTCTTCCCTTAGGG + Intronic
1069734882 10:70647539-70647561 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1070619680 10:77999418-77999440 TTACCACAAAAGTACCCTAATGG - Intronic
1072172411 10:92878429-92878451 TTCCCATGATTCTTCCCTTAGGG + Intronic
1072531217 10:96321346-96321368 TTCCCATGATTCTTCCCTTAGGG + Intronic
1074227904 10:111505537-111505559 TTCCCATGATGCTTCCCTTAGGG + Intergenic
1077679727 11:4227588-4227610 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1077681753 11:4248319-4248341 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1077689144 11:4324163-4324185 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1077702267 11:4453375-4453397 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1078307736 11:10207234-10207256 TTCCCACGAAACTACCCTTAAGG + Intronic
1078552328 11:12289231-12289253 TTCGCACAAAACAACCCTAAGGG + Intronic
1081323289 11:41716781-41716803 TTCCCATGATTCTACCCCTAGGG + Intergenic
1085490799 11:76915296-76915318 TTCCCATGATACTTCCCTTAGGG + Intronic
1085964017 11:81498707-81498729 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1092552377 12:9517231-9517253 TGCCCCCTAAACTACCCTTGGGG + Intergenic
1092683471 12:11015252-11015274 TTCCCACGATTCTTCCCTTAGGG - Intronic
1094475210 12:30835478-30835500 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1094519742 12:31173380-31173402 TGCCCCCTAAACTACCCTTGGGG - Intergenic
1095304971 12:40628086-40628108 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1097194490 12:57236093-57236115 TTCCCACGACTCTGCTCTTAGGG - Intronic
1097451487 12:59742072-59742094 TTCCCATGATTCTTCCCTTAGGG + Intronic
1104356564 12:128091869-128091891 ATCCCACAAAAGTACCCTTCAGG - Intergenic
1104693388 12:130844930-130844952 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1107352866 13:39534129-39534151 TTACCATGAAACTAACCTTGAGG + Intronic
1110869315 13:80432062-80432084 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1111517255 13:89350823-89350845 TTCCCATGATTCTTCCCTTATGG - Intergenic
1111798851 13:92958059-92958081 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1113084805 13:106557352-106557374 TTGCCAGGAAACTATCATTAGGG - Intronic
1114353951 14:21886907-21886929 TTCCCATGATCCTTCCCTTAGGG - Intergenic
1114426672 14:22629553-22629575 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1117282728 14:54256434-54256456 CTCCCACGATTCTTCCCTTAGGG - Intergenic
1117307764 14:54493249-54493271 TTCCCACGATTCTTCCCTTAGGG + Intergenic
1123778328 15:23602139-23602161 TTCCCATGATTCTTCCCTTAGGG + Intronic
1129057280 15:72829654-72829676 TACCCACGGAACTACACCTAAGG + Intergenic
1131583478 15:93668333-93668355 TTCTCATTAAACTACTCTTAAGG - Intergenic
1147641309 17:42002438-42002460 TTCCTAAGACACTACCCCTATGG + Intronic
1149011430 17:51860776-51860798 CTCCCACTAAAATACCTTTAGGG + Intronic
1149799625 17:59555295-59555317 TTCCCATGATATTTCCCTTAGGG + Intergenic
1152702551 17:81826183-81826205 CTCCCAAGCAACTACCCTTCCGG + Exonic
1153252282 18:3134754-3134776 CTCCCACGAAACTACCACTGAGG + Exonic
1156018328 18:32571013-32571035 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1156291254 18:35750403-35750425 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1157915056 18:51656273-51656295 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1159602501 18:70441949-70441971 TTCCCATGATTCTCCCCTTAGGG - Intergenic
1159643333 18:70888622-70888644 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1164586836 19:29481020-29481042 TTCCCAGGAAACCAACCTTCAGG + Intergenic
1165543155 19:36509113-36509135 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1167462697 19:49634679-49634701 ATCCCAAGAAAATACCCATAAGG + Intergenic
926630243 2:15129193-15129215 TTCCCATGCAAGCACCCTTACGG - Intergenic
937340942 2:121090176-121090198 TTCCCATGATTCTTCCCTTAGGG + Intergenic
938290777 2:130149046-130149068 TTCCCATGATCCTTCCCTTAGGG + Intergenic
939250888 2:139680553-139680575 TTCCCATGATTCTTCCCTTAGGG + Intergenic
940117553 2:150225682-150225704 TTCCCATGATTCTTCCCTTAGGG + Intergenic
940316455 2:152332656-152332678 TTCCCATGATTCTTCCCTTAGGG + Intergenic
940904761 2:159159074-159159096 ATCCCACCAAACTACCTATAGGG + Intronic
942314996 2:174689902-174689924 TTCCCAGGAAAGTCCCATTAGGG - Intergenic
943378911 2:187118610-187118632 TTCCCATGATTCTTCCCTTAGGG + Intergenic
944395812 2:199264704-199264726 ATCCTAGGAATCTACCCTTAAGG - Intergenic
944973957 2:205026049-205026071 TTCTCATGAAACTTCCCTTCTGG + Intronic
1177059385 21:16352247-16352269 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1178524778 21:33318345-33318367 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1182055344 22:27349187-27349209 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1184213454 22:43050977-43050999 TTCCCATGACTCTACCCATAGGG + Intronic
951808663 3:26675790-26675812 TTCCCAAGAAACAACAATTAAGG - Intronic
954889597 3:53913142-53913164 TTCCCATGATTCTTCCCTTAGGG + Intergenic
955889803 3:63637790-63637812 TTCCTATGAAACTCCCCCTAAGG + Intergenic
956153653 3:66270446-66270468 TTCCCATGAAGCTAGCATTATGG - Intronic
958072851 3:88636904-88636926 TTCCCATCAAACTACCATTGAGG - Intergenic
959129381 3:102334494-102334516 TTCCCACAAAACTCTCCTTGTGG + Intronic
959281191 3:104343151-104343173 TTCCCATGATTCTTCCCTTAGGG + Intergenic
960173298 3:114488168-114488190 TTCCCACAACACTCCCCTGAAGG + Intronic
960246020 3:115401149-115401171 TTCCCAAGATTCTTCCCTTAGGG - Intergenic
963268357 3:143261184-143261206 TTCCCATGATTCTTCCCTTAGGG - Intergenic
963584190 3:147163743-147163765 TTCCCACGATTCTTCCCTTAGGG + Intergenic
968290341 3:197534103-197534125 TTTGCAAGATACTACCCTTAGGG - Intronic
971621790 4:28863770-28863792 TTCCCATGATTCTTCCCTTAAGG + Intergenic
975908522 4:79243896-79243918 TTCCCATGATTCTTCCCTTAGGG + Intronic
980681015 4:136160203-136160225 TTCCCATGATTCTTCCCTTATGG - Intergenic
980700845 4:136428250-136428272 TTCCCACAAAATTACATTTAGGG - Intergenic
983184174 4:164682257-164682279 TTCCCATGATTCTTCCCTTAGGG + Intergenic
983289577 4:165784995-165785017 TTCCCAAGACACTACCCATCTGG - Intergenic
986454617 5:7903876-7903898 TTCCCACGATTCTTTCCTTAGGG + Intronic
987205273 5:15619052-15619074 TTCCCATGATTCTTCCCTTAGGG + Intronic
987222036 5:15800788-15800810 TTCCGAGGTAACTAGCCTTATGG - Intronic
987701503 5:21405475-21405497 TTCCCATGATTCTTCCCTTAGGG - Intergenic
989819908 5:45784653-45784675 TTCCCATGATTCTTCCCTTAGGG + Intergenic
990114449 5:52370712-52370734 CTCCCACGAAATGACCTTTAGGG - Intergenic
994131940 5:96239583-96239605 TTTCCACTAATCTGCCCTTAGGG + Intergenic
995818540 5:116200393-116200415 TGCCAAAGAAACTACACTTAAGG - Intronic
996213494 5:120840074-120840096 TTCCCATGATTCTTCCCTTAGGG - Intergenic
996303267 5:122015126-122015148 TCCCCAAGAAACTGCCCTTCAGG - Intronic
996735027 5:126750538-126750560 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1005106441 6:22229191-22229213 TTCCCATGACTCTTCCCTTAGGG + Intergenic
1011294296 6:85809781-85809803 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1012232979 6:96782334-96782356 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1014032089 6:116717747-116717769 TTCCCATGATTCTTCCCTTAAGG + Intronic
1014153761 6:118088414-118088436 TTCCCAAGAAACTACTTTTGTGG - Intronic
1014738382 6:125121369-125121391 TTCCCATGATTCTTCCCTTAGGG + Intronic
1016720324 6:147288881-147288903 TTCCCATGATTCTTCCCTTAGGG + Intronic
1016847319 6:148581290-148581312 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1019041658 6:169110940-169110962 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1020788477 7:12596139-12596161 TTCCCATGATTCTTCCCTTAGGG + Intronic
1022916042 7:34953920-34953942 TTCCCAGGAATCTTCCCTGAGGG - Intronic
1023173134 7:37409435-37409457 TTCTCATGAAACTACCATTTGGG + Intronic
1023293574 7:38692122-38692144 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1024887550 7:54161681-54161703 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1028343108 7:89746672-89746694 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1028360838 7:89964534-89964556 TTCCCATGATTCTTCCCTTACGG - Intergenic
1030257722 7:107529613-107529635 TTCCCAAGATTCTTCCCTTAGGG - Intronic
1030516948 7:110550592-110550614 TTCCCAAGAATCCACCCTTGTGG + Intergenic
1035945243 8:3954692-3954714 TTCCCATGATTCTTCCCTTAGGG + Intronic
1036108390 8:5869682-5869704 TTTCCAAGAAACAACTCTTACGG + Intergenic
1042667429 8:71221957-71221979 TTCCCATGCATCTTCCCTTAGGG - Intronic
1043034727 8:75181878-75181900 TTACCACTAGACCACCCTTATGG + Intergenic
1043517545 8:81009438-81009460 TTCCCATCAAACTAACCTTAGGG + Intronic
1046028237 8:108750785-108750807 TTCCCAAGATTCTCCCCTTAGGG - Intronic
1046133669 8:109998528-109998550 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1051278769 9:15421438-15421460 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1051997298 9:23233264-23233286 TTCCCACGATTCTTTCCTTAGGG - Intergenic
1052669597 9:31538915-31538937 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1055253626 9:74338852-74338874 TTCCCATGACTCTTCCCTTAGGG + Intergenic
1055610857 9:78022390-78022412 TTCCCACATAACTAACCTCAGGG - Intronic
1056309303 9:85322946-85322968 TTCCCAGGATACTTCCCTTAGGG - Intergenic
1059598005 9:115744161-115744183 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1186021783 X:5264427-5264449 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1186234958 X:7498018-7498040 TTCCCATGATTCTCCCCTTAGGG + Intergenic
1186373024 X:8966456-8966478 TTCCCACGATTCTTCCCTTGGGG + Intergenic
1187084508 X:16028048-16028070 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1192811909 X:74554590-74554612 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1193919174 X:87404944-87404966 TTCCCATGATTCTTCCCTTAGGG - Intergenic
1194802568 X:98290947-98290969 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1195318668 X:103703240-103703262 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1197295724 X:124716872-124716894 CTCCCATGATTCTACCCTTAGGG - Intronic
1197555281 X:127945843-127945865 TTCCCATGATTCTTCCCTTAGGG + Intergenic
1197625616 X:128798948-128798970 TTCCCACCACATTACCTTTAAGG + Intergenic
1201056987 Y:10003697-10003719 TTCTCACGAAATTACACTCAAGG - Intergenic
1201601208 Y:15730451-15730473 TTCCCATGATTCTACCCTGAGGG + Intergenic