ID: 1078313775

View in Genome Browser
Species Human (GRCh38)
Location 11:10273785-10273807
Sequence TTGGATGGAAAACTGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078313771_1078313775 11 Left 1078313771 11:10273751-10273773 CCTGATATCAATCATACAGAAAA 0: 1
1: 0
2: 0
3: 16
4: 287
Right 1078313775 11:10273785-10273807 TTGGATGGAAAACTGGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 193
1078313769_1078313775 24 Left 1078313769 11:10273738-10273760 CCTGAAGCATAGCCCTGATATCA 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1078313775 11:10273785-10273807 TTGGATGGAAAACTGGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 193
1078313770_1078313775 12 Left 1078313770 11:10273750-10273772 CCCTGATATCAATCATACAGAAA 0: 1
1: 0
2: 1
3: 13
4: 220
Right 1078313775 11:10273785-10273807 TTGGATGGAAAACTGGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078313775 Original CRISPR TTGGATGGAAAACTGGAACC AGG Intronic
901289688 1:8114230-8114252 TTGGTTGGATAACTGGAAGACGG + Intergenic
902295756 1:15465897-15465919 ATGGATGGAAGACAGGAACAGGG + Intronic
902360852 1:15941915-15941937 ATGGATGGCACCCTGGAACCGGG - Exonic
903123494 1:21232235-21232257 TTGGACTGAAGACTGGAACTGGG + Intronic
905766813 1:40608284-40608306 TTTGTTGGAAAACAGGAACTAGG + Intergenic
907919004 1:58895781-58895803 TTGGGTGGGAAGCTGGACCCAGG - Intergenic
908086196 1:60636716-60636738 TTGGAAGGAAAAAAGGAAACAGG + Intergenic
908176072 1:61556297-61556319 GTGGATGGTAAAATGGAAACAGG - Intergenic
908505970 1:64800630-64800652 TTGAGTGGAAAACTGGTACACGG - Intronic
908770857 1:67594395-67594417 TGGTTTGGAAACCTGGAACCAGG + Intergenic
915249624 1:154578853-154578875 CTGGATGGAAACCTGGAGCAAGG + Exonic
916966070 1:169944579-169944601 CTGGATGGGAAACAAGAACCTGG - Intronic
918222578 1:182449344-182449366 GTGGAGGGAAAACTGAAAACTGG - Intergenic
918352935 1:183676522-183676544 TTGTATGAAAAATTGGGACCTGG + Intronic
918705616 1:187658030-187658052 ATGGATGGAAAAATGGGACTTGG + Intergenic
919151340 1:193703839-193703861 TTGGACAGAAAATTGGAAGCAGG - Intergenic
919413196 1:197273067-197273089 TTGGATGGGATACTAGAACAGGG - Intronic
919927319 1:202199088-202199110 TTGGATGAAAAACTAGAAAGTGG + Intronic
921158532 1:212456389-212456411 TTGGAAAGAACACTGGATCCAGG + Intergenic
921264965 1:213414774-213414796 TTAGATGGGTAACTGGAAGCAGG + Intergenic
921520929 1:216153077-216153099 ATGGATGGGAAACTGGAAAGGGG - Intronic
924038885 1:239963949-239963971 TTCGATGTAAACCAGGAACCAGG + Intergenic
1063259116 10:4364479-4364501 TTAGAGGAAAAAATGGAACCAGG + Intergenic
1063995927 10:11619190-11619212 TTGGGGGGGAAAGTGGAACCCGG - Intergenic
1065551011 10:26868618-26868640 TTGGAAGGACAGCAGGAACCTGG + Intergenic
1066564826 10:36710550-36710572 ATGGATGGAAAGCTGGAAGGGGG - Intergenic
1067016577 10:42760408-42760430 TTGCCTGGAAAACTGGAAAAAGG - Intergenic
1069466297 10:68642338-68642360 ATGGAAGGATAACTTGAACCTGG + Intronic
1070821050 10:79354708-79354730 TTCTATGGAAGACTGGTACCTGG + Exonic
1071216159 10:83404458-83404480 GTGGAGGGAAAACTGGATCTTGG - Intergenic
1073491960 10:103858518-103858540 GTGAATGGAGAACTGGAACCAGG - Intergenic
1076933789 10:133554240-133554262 TTCCATGGAAAAATGGAACATGG - Intronic
1077791400 11:5444425-5444447 TTAGATGGAAACCTGGCATCAGG + Intronic
1078005406 11:7528885-7528907 CTGGATGGAGAACTGGGCCCTGG - Intronic
1078313775 11:10273785-10273807 TTGGATGGAAAACTGGAACCAGG + Intronic
1078720324 11:13878154-13878176 TGTGATGGAAAATTGGACCCAGG + Intergenic
1082748680 11:56995497-56995519 ATGGATGGAGAACTGGAAGGGGG + Intergenic
1083918449 11:65765870-65765892 TTGGATGGATAATTGGAAGGGGG + Intergenic
1085564574 11:77501543-77501565 TTGTATGGATCACTGGAACAGGG - Intergenic
1086063194 11:82721092-82721114 TTGGATGCAAAAGAGGGACCAGG + Intergenic
1086257936 11:84902132-84902154 TTGAATGGAAATCTGGACGCAGG + Intronic
1087896352 11:103590666-103590688 TTTGATGTAAAAATGGATCCAGG + Intergenic
1088659790 11:112034271-112034293 TTTGAGGGAAAACTGAAACCAGG + Intronic
1090359689 11:126163711-126163733 TTGTATTGAAAACAGGAGCCAGG - Intergenic
1090609512 11:128457678-128457700 TTGGAGGGATAACTGCAACTTGG + Intergenic
1091485145 12:879569-879591 CTGGCTGGGAAACTGGAAGCTGG - Exonic
1093751790 12:22808079-22808101 TGGGATGGGGAACTGGAAACAGG + Intergenic
1096008696 12:48194337-48194359 TGGGATTGACACCTGGAACCTGG + Intergenic
1097633324 12:62091154-62091176 TTAGATGAAAAGCTGGAACTTGG - Intronic
1098072322 12:66689143-66689165 TTTGATGGGAAACTGGACCGAGG - Intronic
1098325016 12:69292394-69292416 TTGTATTCAAAACTGGTACCTGG - Intergenic
1098811593 12:75101192-75101214 TTGAATGGATATATGGAACCTGG - Intronic
1098986964 12:77023048-77023070 TTATATGGAAAATTGGAACCTGG - Exonic
1099447189 12:82766352-82766374 GTTGATGAAAAACAGGAACCTGG - Intronic
1102087482 12:110154531-110154553 TGAGATGGAAAAATTGAACCCGG + Intronic
1103070052 12:117933868-117933890 GTGGATGGAGAACTGGAGCACGG - Intronic
1104598708 12:130138054-130138076 ATGGGTGGATCACTGGAACCCGG - Intergenic
1108578118 13:51806476-51806498 TTGAGTGGCAAATTGGAACCAGG - Intergenic
1109479918 13:62938323-62938345 TGGGATGAAAAACTGCAACAGGG - Intergenic
1110071330 13:71182585-71182607 TTGGATGGGGAACTGGAAAGGGG + Intergenic
1110285918 13:73750332-73750354 TTGGTAGGAAAACTGAAGCCCGG - Intronic
1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG + Intergenic
1111546923 13:89750283-89750305 TGGGATGGACAAATAGAACCTGG + Intergenic
1114068853 14:19092356-19092378 TTGCCTGGAAAACTGGAAAAAGG + Intergenic
1114093408 14:19307649-19307671 TTGCCTGGAAAACTGGAAAAAGG - Intergenic
1114524963 14:23361860-23361882 TTGGAAAGAAAACTGGAAGAGGG + Intronic
1116219396 14:42063118-42063140 TTTCTTGTAAAACTGGAACCAGG - Intergenic
1120287738 14:82525868-82525890 TTCGATGGAAAGCTGGAAAAAGG + Intergenic
1120952233 14:90051963-90051985 AGGGATGGAAAGGTGGAACCAGG - Intergenic
1122224600 14:100266629-100266651 TTGGATGGCTATCTGGTACCCGG - Intronic
1124386199 15:29209927-29209949 TTGGATGCAAAAGTGTCACCTGG + Intronic
1124549628 15:30667439-30667461 ATGGATGGATAACTTGAACCCGG - Intronic
1125492238 15:40156991-40157013 TTGGACGGAAAACTAGAAATAGG + Intergenic
1126617946 15:50605342-50605364 TTGGATGAATCTCTGGAACCTGG - Intronic
1127936770 15:63648121-63648143 TTTGATGGAAAACTGTTACTGGG - Exonic
1130403588 15:83579266-83579288 TTGGAGGAAACACTGCAACCAGG - Intronic
1131344841 15:91636955-91636977 TAGGATGGAGAAGTGGAACCAGG + Intergenic
1132323686 15:100947251-100947273 TTGATTTGAAAACTGGAGCCTGG - Intronic
1135199982 16:20429102-20429124 GTGGGAGGAAAGCTGGAACCTGG - Intronic
1135218719 16:20594506-20594528 GTGGGAGGAAAGCTGGAACCTGG + Intergenic
1138198049 16:55068691-55068713 TTGGATGGTGAACAGCAACCTGG + Intergenic
1140425652 16:74859108-74859130 TTGGATGGAAAAGTAGAATCAGG + Intergenic
1150763459 17:67984468-67984490 TTTTATGGAAATCTGAAACCAGG + Intergenic
1151041735 17:70869605-70869627 TAAGATGGAAATCTGGAAACTGG + Intergenic
1151225492 17:72644878-72644900 TTGGAATGGAAACTGGAAGCGGG + Intergenic
1152929249 17:83101564-83101586 TTTGTGGGAGAACTGGAACCTGG + Intergenic
1157755567 18:50214265-50214287 CTGGAGGGAAAAATGGATCCAGG - Intergenic
1158269453 18:55697134-55697156 TTTGAGGGACAACTGGAAACGGG + Intergenic
1159952951 18:74497997-74498019 TGGGAGGAGAAACTGGAACCTGG + Intronic
1164561240 19:29293657-29293679 TTAGATGGAAAATTGGAACTAGG + Intergenic
1168446765 19:56424645-56424667 TTGGAAGGTAACCTGGAACAAGG - Exonic
926227428 2:10978393-10978415 ATGGATGGAAATCTGAAACTGGG - Intergenic
928910786 2:36418612-36418634 TTGCATAGAAAAGGGGAACCCGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
930496654 2:52153654-52153676 GAGGATAGAAAACTGGAATCTGG + Intergenic
932634553 2:73377096-73377118 TTGGAGGGCTAACTGGAAACTGG - Intergenic
935542347 2:104363297-104363319 TTGGAAGAAAAAATAGAACCAGG - Intergenic
935979327 2:108611141-108611163 TTGAGTGAAAAACTGAAACCTGG - Intronic
937201943 2:120209573-120209595 TTGGATGGGACACCTGAACCTGG - Intergenic
939797595 2:146666049-146666071 TTGGATATCAAACTGGAAACAGG + Intergenic
939955794 2:148526891-148526913 TTCCATGGGAAACTGGAACTGGG + Intergenic
940414632 2:153405299-153405321 TTCCATGTAAAACTGGCACCAGG + Intergenic
940826637 2:158419892-158419914 TAGAAAGGAAAACTGGAACCAGG + Intronic
940935540 2:159490269-159490291 TTGGATTGAAAAGTGTAACAAGG - Intronic
943723531 2:191229884-191229906 GTGGAAGGATAACTTGAACCAGG - Intergenic
944673626 2:202016723-202016745 TTGGTGGGAACACTGGAAACAGG - Intergenic
948219274 2:236256436-236256458 TTGGATGGGAAGCTAGAATCAGG + Intronic
948287060 2:236793936-236793958 TTGCAGGGATAACTGCAACCCGG - Intergenic
1170801994 20:19598264-19598286 TTGAATGGAAACCTGGAGCCTGG + Intronic
1174191448 20:48743434-48743456 GTGGAGGGAGAACTGGAAGCCGG - Intronic
1174568579 20:51484738-51484760 CTGGTTGGACAACTGGTACCTGG + Intronic
1174740615 20:53010174-53010196 TTGGATGGAACCCAGGAATCTGG + Intronic
1174994734 20:55553295-55553317 TTGGATGGAAGACTAAATCCTGG + Intergenic
1175191920 20:57217133-57217155 TGGGATTGAGAGCTGGAACCAGG - Intronic
1178471222 21:32894574-32894596 TAGGATGGAAAATTGGAAAGTGG + Intergenic
1179043109 21:37822381-37822403 TTGGGGGAAAAAATGGAACCAGG - Intronic
1179187401 21:39095571-39095593 TTGGATTGAAAAGAAGAACCAGG - Intergenic
1180487325 22:15814916-15814938 TTGCCTGGAAAACTGGAAAAAGG + Intergenic
1182144717 22:27990376-27990398 GTGGATGGCGAAGTGGAACCCGG + Intronic
1183143061 22:35962311-35962333 TTGGATGGAAAGTTGGACCCAGG - Intronic
1184914585 22:47560761-47560783 GTGGATGAAAAACTGGAGCTTGG + Intergenic
949578408 3:5361358-5361380 TGGGCTGGATAATTGGAACCAGG + Intergenic
950271841 3:11622879-11622901 TTGGACTGAGAACTGAAACCTGG + Intronic
950571244 3:13801335-13801357 TTGGATAGCAAGCTGGAAGCTGG + Intergenic
951304703 3:21044215-21044237 TTAGATGGAAAAATGGTACTTGG + Intergenic
956069283 3:65430698-65430720 TTGGATGGCAAGATGGAAACAGG - Exonic
956426078 3:69136806-69136828 TTGACTGGAAAATTGGCACCAGG + Intergenic
956443707 3:69305316-69305338 TTGCAAGGAAAGCTGGAAACAGG - Intronic
959560574 3:107775137-107775159 TCGGATGGAAAAATGCATCCTGG - Intronic
960268418 3:115647866-115647888 TTGCATGGAAGACTGGAGGCAGG + Intronic
960813062 3:121643572-121643594 TTGGTGGGATAACTGCAACCAGG + Intronic
963191735 3:142480734-142480756 GTGGCTGGAAAGCTGGAACTGGG - Intronic
965661840 3:171050143-171050165 TTACATGGCAAACTGAAACCTGG + Intergenic
970197039 4:13561462-13561484 GTGGGTGGAAAATTGGAAACTGG - Intergenic
970389373 4:15592165-15592187 TTGGATGGAATAGTGGAGCATGG - Intronic
970688636 4:18596864-18596886 ATGGATGGATAAATGGAAACAGG + Intergenic
970768732 4:19584154-19584176 TTGGCTGGTAAACAGGAACCAGG + Intergenic
971470381 4:27018600-27018622 TTGATTGGAAAACTGGAAGAAGG + Intronic
971602962 4:28619305-28619327 TTGGCTTGAAAGCTGGAGCCAGG - Intergenic
976197055 4:82543109-82543131 TTGCTGGGAATACTGGAACCAGG + Intronic
982090567 4:151876682-151876704 TTGCCTGGAGACCTGGAACCTGG + Intergenic
982202518 4:152974356-152974378 TTGGCTGGAAAGCTGGAAGTTGG + Intronic
984373353 4:178894719-178894741 TTGGATGCAGAACAAGAACCTGG - Intergenic
985124262 4:186675887-186675909 TTGGATCTTAATCTGGAACCTGG + Intronic
990122505 5:52472158-52472180 TTGGAGGAAAAACTTGACCCAGG - Intergenic
991399621 5:66239415-66239437 TTTGATTGAAAACTGGAAGGAGG + Intergenic
991541342 5:67732736-67732758 TTGGAGGAAGAACTGAAACCTGG + Intergenic
991695334 5:69265814-69265836 TTGGCAGGATCACTGGAACCTGG + Intronic
995740254 5:115348418-115348440 AGGGATTGAAAACTGGAAGCAGG + Intergenic
998950967 5:147392815-147392837 TGGAATGGAAAGGTGGAACCAGG + Exonic
1000404381 5:160871516-160871538 TTGGAGGGAAAAGTGGAAAAGGG - Intergenic
1000522077 5:162307634-162307656 TGGGATGGAAGAGTGGAAGCAGG - Intergenic
1000567980 5:162874902-162874924 TGTGTTGGAAAACAGGAACCAGG + Intergenic
1002799690 6:510353-510375 TGGGATGGAAAACAGAAAGCAGG - Intronic
1002946409 6:1765671-1765693 TTGGGTGGAAAACTGGCCCAGGG - Intronic
1003068279 6:2921336-2921358 ATGTATGGAAAACAGGAACTCGG + Intergenic
1005450746 6:25969574-25969596 ATGGATGTAAACCTGGAACCAGG - Intronic
1005711434 6:28506659-28506681 TTGGATGGTAAAGTGTAGCCAGG - Intronic
1007522855 6:42465802-42465824 GTGGAAGAATAACTGGAACCTGG - Intergenic
1008075129 6:47137938-47137960 TTGCGTGGAAAACTGGCACTTGG + Intergenic
1008931890 6:56949092-56949114 CTGGATGGCAAAATGGAACTAGG - Intronic
1012492272 6:99795381-99795403 GTGGAAGGAAAACTGGAAGCAGG - Intergenic
1013008037 6:106092714-106092736 TTGGAGGGGGAACAGGAACCAGG - Intronic
1018282024 6:162197003-162197025 TAAGGAGGAAAACTGGAACCTGG - Intronic
1018549809 6:164982993-164983015 CTGGATGGAACACTGGAACAGGG - Intergenic
1020882444 7:13779008-13779030 TTGGATGGAGCACTGGAGCTGGG + Intergenic
1024936373 7:54716107-54716129 TTGGCTGTAAAACTTGGACCTGG - Intergenic
1025106167 7:56174107-56174129 TAGGATGGAAAACTGACAGCAGG - Intergenic
1025704923 7:63854572-63854594 TTGCATGCATAATTGGAACCAGG - Intergenic
1025814726 7:64900934-64900956 TGGCATGGAAAACTAGAACATGG - Intronic
1026134427 7:67646940-67646962 GTGGATGGAATACTGGAACACGG - Intergenic
1026316340 7:69231009-69231031 TAGGATGGAAAACTGACAGCAGG - Intergenic
1027452085 7:78343777-78343799 CAGGATGGAAAAATGGAAACAGG - Exonic
1027871813 7:83717034-83717056 GTGGCTGCAAAACTGGAACTGGG - Intergenic
1033918382 7:146356716-146356738 TTGGATGGAGAAGTGGATCATGG + Intronic
1040612383 8:48998089-48998111 GTGGCTGGGAAGCTGGAACCGGG + Intergenic
1043584627 8:81754002-81754024 TTGGATGTGATAGTGGAACCTGG + Intronic
1045495295 8:102703017-102703039 TCAGATGGAAAACAGGTACCTGG - Intergenic
1045518858 8:102885651-102885673 TTGGAAGGAAAAGGGGAAGCAGG + Intronic
1046308369 8:112400078-112400100 TAAGATGGAAAATTGGTACCAGG - Intronic
1046724700 8:117661848-117661870 TTGGATTGAAAATAGGAAACAGG - Intergenic
1046869380 8:119188367-119188389 TTGAACTGAAAACTGGATCCAGG + Intronic
1047346134 8:124030682-124030704 CTAGATGGAAAGCTGGAACCTGG - Intronic
1047762887 8:127967225-127967247 TTGAATGGAAAACCTGACCCGGG + Intergenic
1048384372 8:133897918-133897940 TTTGATAGAAAGCAGGAACCAGG - Intergenic
1049562666 8:143319592-143319614 CTTGAAGGAAGACTGGAACCTGG - Intronic
1051681280 9:19610510-19610532 TTGGATGGAAGAGAGGAACAAGG + Intronic
1055017768 9:71637396-71637418 ATGGATGGAAACATGGAAGCAGG - Intergenic
1055098624 9:72440278-72440300 AGGGATAGAAAAGTGGAACCAGG - Intergenic
1055370853 9:75597387-75597409 TTGGAAGGAAAACTAGAAGAAGG - Intergenic
1057077534 9:92146570-92146592 TTGGATGAAAAACTAGAAAGTGG + Intergenic
1057082269 9:92181671-92181693 ATAGATTGAAAACTAGAACCAGG - Intergenic
1057163975 9:92912332-92912354 TTAGCTGAAAAACTGGAATCAGG + Intergenic
1057757137 9:97847772-97847794 TCGTATGGGCAACTGGAACCCGG + Intergenic
1059398496 9:114053937-114053959 TTGGCTGGAAAAAGGGTACCAGG + Exonic
1059925017 9:119200681-119200703 CTGGATGGTAAACTGGAACTTGG + Intronic
1060960768 9:127679029-127679051 TTGGATGGAAAGCAGGATCTGGG - Intronic
1062176903 9:135168430-135168452 TTGGAATGAAAAATGGAACAAGG - Intergenic
1062201779 9:135306756-135306778 TGGGATCCAAAACTGGATCCCGG - Intergenic
1185493651 X:537974-537996 TTGGAGGGAAAAATGGAGCCAGG + Intergenic
1187312020 X:18154123-18154145 TTGGATAGAAAAATGAACCCAGG - Intergenic
1188165224 X:26854377-26854399 TTGGGAGGAAAACTGGAGGCAGG - Intergenic
1190083309 X:47373792-47373814 TTGGAAGGATCACTTGAACCCGG - Intronic
1191840488 X:65510272-65510294 TTGGCTGGTATCCTGGAACCTGG - Intergenic
1191885288 X:65881751-65881773 TTAGATGCATAAGTGGAACCTGG - Intergenic
1192570138 X:72196565-72196587 TTAGATGGAAAATAGGCACCTGG - Intronic
1192656814 X:73002208-73002230 TTAGATGGTGAACTGGGACCAGG + Intergenic
1192665306 X:73080793-73080815 TTAGATGGTGAACTGGGACCAGG - Intergenic
1197569386 X:128130705-128130727 GTGGAAGGAAAAATGGAAGCAGG - Intergenic
1198815949 X:140590293-140590315 TTGGATGGACAAGTTGAACTTGG + Intergenic
1200582628 Y:4968809-4968831 GTGGATGGAGGACAGGAACCAGG + Intergenic
1202600963 Y:26592675-26592697 TTGGATGGAATCCAGGAATCAGG - Intergenic