ID: 1078324882

View in Genome Browser
Species Human (GRCh38)
Location 11:10371388-10371410
Sequence ATGTTCTCCTTTAATAACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078324882 Original CRISPR ATGTTCTCCTTTAATAACTT AGG (reversed) Intronic
902961597 1:19967385-19967407 ATTTTCTCCTTGATTATCTTAGG + Intergenic
903523253 1:23971902-23971924 ATCTCCTCCTTTCATAACTTCGG + Exonic
907898702 1:58717742-58717764 TTGTTCTAATTTAAGAACTTAGG + Intergenic
908706287 1:66959442-66959464 ATGATTTCCTATAAAAACTTAGG - Intronic
908789200 1:67764709-67764731 GTGTTCTCCTTCAATAACCGGGG + Intronic
910742972 1:90541537-90541559 ATGTTCTCTTTCTATAATTTCGG - Intergenic
910991792 1:93064146-93064168 AGGTTTTCCTTGAATAACATGGG - Intergenic
911961718 1:104312390-104312412 ATGAATTCCTTTATTAACTTTGG + Intergenic
912032968 1:105272992-105273014 AAGTTCTCCTTCAGTAACTCAGG + Intergenic
912119367 1:106451554-106451576 ATGTGCTTGTTTCATAACTTTGG + Intergenic
914710114 1:150205503-150205525 ATTTTTCCCTTTAAAAACTTTGG + Intergenic
916439820 1:164812952-164812974 ATTTTCTCATTAAATAAGTTTGG + Intronic
917253782 1:173092278-173092300 ATGTTGTCATTTAAAAACCTTGG - Intergenic
918544105 1:185663054-185663076 CTGTTGTCTTTTAAGAACTTTGG - Intergenic
918996531 1:191768590-191768612 ATGTTTTTCTTAAATAATTTTGG - Intergenic
919053169 1:192536351-192536373 ATGGTTTCATTTAATAATTTTGG - Intergenic
921624971 1:217369971-217369993 TTTTTCTCATTTAAGAACTTTGG - Intergenic
921632528 1:217453255-217453277 ATATTGTTCTTTAATAACTTTGG - Intronic
923407618 1:233678456-233678478 ATGCTCTCATTTTACAACTTGGG - Intergenic
1065066421 10:21970327-21970349 TTGACCTCCTTTAACAACTTAGG - Intronic
1067904337 10:50275189-50275211 ATGTTCTGGTTTAAGAAATTAGG - Intergenic
1068294957 10:55057964-55057986 ATGTTTTGTTTTATTAACTTGGG + Intronic
1068713768 10:60163470-60163492 ATGTTATCATTTAATAAGGTGGG - Intronic
1069203689 10:65655275-65655297 TTCTTGTCCTTTAATAGCTTTGG - Intergenic
1070338864 10:75478552-75478574 AGGCTGTTCTTTAATAACTTTGG + Intronic
1072030556 10:91517815-91517837 ATGGTTTTCTTTAATAATTTTGG + Intergenic
1075674342 10:124285946-124285968 GTGTTTTCCTTTAAAAACTGTGG - Intergenic
1077738532 11:4818504-4818526 ATATTCTTTTTAAATAACTTTGG + Intronic
1078307888 11:10209141-10209163 AACTTCTCCTTTATTGACTTAGG - Intronic
1078324882 11:10371388-10371410 ATGTTCTCCTTTAATAACTTAGG - Intronic
1080772629 11:35355918-35355940 ATGGTCTCCTTGAACAAGTTAGG + Intronic
1082641556 11:55667234-55667256 ATGTTCTCCTTTGATAAGTAAGG + Intergenic
1082792125 11:57353355-57353377 ATCTTCTCCTTTATAAAGTTGGG - Intronic
1083025344 11:59546075-59546097 ATGTTCTGTTTTAACAACTTAGG + Intergenic
1083047158 11:59747496-59747518 ATCTTCTCCTTTACTATCTTGGG - Intronic
1083978124 11:66141207-66141229 AAGTTCTCCTTTGATGAGTTTGG + Intronic
1084386774 11:68848061-68848083 ATGCTCTCATTTAAAAACTCAGG - Intergenic
1085374911 11:76051718-76051740 GATTTCTCCTTTAAAAACTTTGG + Intronic
1085776938 11:79375286-79375308 ATGTTCTTATTTAAAAAATTTGG + Intronic
1086600721 11:88630068-88630090 ATCTTCTCCCTTAACGACTTGGG + Intronic
1087952076 11:104234060-104234082 ATTTTCTTCTTTTATAACGTAGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1091244855 11:134083406-134083428 ATTTTCTCCTTTACTACCCTGGG + Intronic
1091557597 12:1586625-1586647 AGGTTCTCCTCTAATTACCTAGG + Intronic
1091610413 12:2003096-2003118 ATTTCCTCCGTTAAGAACTTTGG + Intronic
1093841960 12:23914279-23914301 ATGTTCTACTTTTATAACAGTGG - Intronic
1094630555 12:32169680-32169702 ATATTATCCTTTGATAACCTAGG + Intronic
1095425643 12:42071812-42071834 ATTATATCCTTTAATAACATTGG + Intergenic
1095668129 12:44826551-44826573 TTGTTCACCTTTAAAGACTTCGG - Intronic
1099212776 12:79813812-79813834 TTATTTTCTTTTAATAACTTGGG - Intronic
1099420755 12:82457247-82457269 ATGTTATCAATTACTAACTTGGG - Intronic
1099772864 12:87084949-87084971 CTGTTGTACTTCAATAACTTGGG + Intergenic
1100177100 12:92043331-92043353 ATGTTCTCATTGAATAAATAAGG + Intronic
1100177288 12:92045393-92045415 ATGTTATCATTTAATAAATAAGG + Intronic
1100902971 12:99264382-99264404 ATATTCTACTTTACTGACTTGGG + Intronic
1104623259 12:130333984-130334006 GTTTTCTGCTTTAAAAACTTGGG + Intergenic
1105970241 13:25422741-25422763 ATTTTTTCCTTTAAAAACTTTGG - Intronic
1106836853 13:33643969-33643991 AGGTTCTCCTTTAAAAATTGAGG + Intergenic
1106861784 13:33917448-33917470 AGGATCTCCTTAAATAAATTAGG + Intronic
1107161266 13:37231393-37231415 AGGATCTTCTTTATTAACTTTGG - Intergenic
1108115423 13:47122116-47122138 ATGTGCTAATTTAATATCTTTGG - Intergenic
1108139450 13:47403884-47403906 AAATGCTCATTTAATAACTTAGG + Intergenic
1108792698 13:53991359-53991381 ATCTACTTCTTTAAAAACTTAGG + Intergenic
1109631348 13:65051922-65051944 ATTTTCACATTTATTAACTTAGG - Intergenic
1109730374 13:66405466-66405488 ATGTTCTCCTTGAAATCCTTTGG - Intronic
1110038670 13:70722011-70722033 ATGTGTCCCTTTAATGACTTAGG + Intergenic
1111104217 13:83624695-83624717 ATATTCTGATTTTATAACTTGGG + Intergenic
1112863576 13:103865696-103865718 ATTTTCTCCTTTAAAAAAATTGG + Intergenic
1113008619 13:105737380-105737402 ATTGTCTCCTATAATAACATGGG + Intergenic
1114767250 14:25387818-25387840 ATTTTCTAATTGAATAACTTTGG + Intergenic
1115561264 14:34585157-34585179 AGGACCTCCTTTAAAAACTTGGG - Intronic
1117526402 14:56610701-56610723 ATATTCTGCTTTAATTATTTTGG + Intronic
1118417830 14:65562555-65562577 ATGTTTTACCTCAATAACTTTGG - Intronic
1118788067 14:69063300-69063322 ATGTTATCATTTATGAACTTGGG + Intronic
1120281270 14:82441564-82441586 ATCTACTCCTTTAATAAGTCTGG + Intergenic
1122472473 14:101980007-101980029 ATGTTACTCTTTAATATCTTTGG + Intronic
1124291983 15:28460531-28460553 ATGTTATCCTTAAATAACTATGG + Intergenic
1125440005 15:39691538-39691560 ATGTTCTTCTTCAAGAAGTTAGG + Intronic
1131658522 15:94487499-94487521 TTTGTCTCCTTTAATAAATTTGG - Intergenic
1133948976 16:10373903-10373925 ATGTTCTCCATTTATCTCTTAGG + Intronic
1136706801 16:32197141-32197163 ATGTTATCCTTAAATAACTGTGG - Intergenic
1136761110 16:32732276-32732298 ATGTTATCCTTAAATAACTGTGG + Intergenic
1136806993 16:33138110-33138132 ATGTTATCCTTAAATAACTGTGG - Intergenic
1137903273 16:52292219-52292241 ATGTTTTCCTCTCATAACCTGGG - Intergenic
1138281257 16:55773611-55773633 ATGTTCTCCTAGAATCACTGAGG + Intergenic
1138287282 16:55820250-55820272 ATGTTCTCCTAGAATCACTGAGG - Intronic
1139412465 16:66775063-66775085 AAATTCTCCTTTATAAACTTTGG + Intronic
1140988218 16:80180219-80180241 ATGTTCTTCTCTCAAAACTTGGG + Intergenic
1142391416 16:89803358-89803380 ATGATGTCCATAAATAACTTTGG - Intronic
1203063262 16_KI270728v1_random:992593-992615 ATGTTATCCTTAAATAACTGTGG + Intergenic
1144184472 17:12783842-12783864 ATTTTCCCACTTAATAACTTAGG - Intergenic
1144239905 17:13300440-13300462 GTGTTATCCTTTAATAAGATGGG + Intergenic
1149796259 17:59523180-59523202 ATTTTATCCTTTAAAAATTTTGG - Intergenic
1150115250 17:62542116-62542138 ATGTTCTATTTTCATAATTTAGG - Intronic
1151056644 17:71039152-71039174 ATGTTCTTATTTAGTAAGTTTGG - Intergenic
1151993555 17:77594207-77594229 ATGTTTTCATTTAAAAACATTGG - Intergenic
1153611826 18:6893618-6893640 ATGTTCTCATCTTATAAATTGGG + Intronic
1155563411 18:27105656-27105678 AAGTTCTCTTTTAATTTCTTTGG + Intronic
1156130196 18:33963578-33963600 TTGTGGTTCTTTAATAACTTTGG - Intronic
1156431536 18:37080369-37080391 ATGTTTTACTTTATTTACTTTGG + Intronic
1156436789 18:37139266-37139288 ATGTTGTTCTTTAAACACTTCGG + Intronic
1157863067 18:51158996-51159018 TGGATCTCCTTTCATAACTTTGG + Intergenic
1158270873 18:55714910-55714932 ATGTTCTCCTGTAATGAATGAGG + Intergenic
1158419115 18:57277327-57277349 TTTTTCCCCTTTAAAAACTTTGG + Intergenic
1159032062 18:63241633-63241655 ATCTTCTGCATTAATAACCTCGG - Intronic
1159973999 18:74687525-74687547 ATATTATCCTTTAATAGTTTTGG + Intronic
1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG + Intergenic
1160468882 18:79108390-79108412 ATGTTCACCATTAATATTTTTGG - Intronic
1164271461 19:23676336-23676358 CTGTTCTTATATAATAACTTGGG - Intronic
1165019799 19:32914711-32914733 TTTTTTTCTTTTAATAACTTTGG - Intronic
1167401021 19:49269355-49269377 TTTTTTTCCTTTACTAACTTGGG + Intergenic
1168236298 19:55065401-55065423 ATGTTTACATTTAATAACATGGG + Intronic
925919636 2:8630177-8630199 ATGCTCACCTTTAATAATTCAGG + Intergenic
927363865 2:22271208-22271230 CTTTTCCCCTTTAATAAATTGGG - Intergenic
928274694 2:29889865-29889887 TTCTTATCCTTCAATAACTTGGG - Intronic
929131681 2:38581382-38581404 GTGTCCTCCTTTAAAAACTTGGG + Intronic
932290118 2:70570079-70570101 ATGTATTACTTTAAAAACTTGGG + Intergenic
937661773 2:124438178-124438200 ATGTTCTACTTTAAGAAAGTAGG - Intronic
938818963 2:134934416-134934438 ATGCTCACCTTTAAAAGCTTTGG + Intronic
939023988 2:136990101-136990123 ATTTTCTCATTTAAGAACTGAGG + Intronic
939290234 2:140184254-140184276 ATGATCTCCATTAATCACTGGGG + Intergenic
939302457 2:140362401-140362423 ATGTTCTCCTCTACTTACTATGG + Intronic
939785239 2:146501726-146501748 AAATTCTCATTTAATAGCTTAGG - Intergenic
940212701 2:151272522-151272544 ATGTTCTATTTTAATATTTTGGG - Intronic
940531229 2:154879340-154879362 ATTTTTTCCTTTAGTAACTTAGG + Intergenic
940998329 2:160174725-160174747 GTGTTCTACTGTAATATCTTTGG - Intronic
941530780 2:166667989-166668011 ATGTTTTATTTTAATAGCTTTGG - Intergenic
941657166 2:168156561-168156583 ATGGTGTCCTCTAATTACTTAGG - Intronic
942571979 2:177324016-177324038 GTGATTTTCTTTAATAACTTGGG - Intronic
943039190 2:182783757-182783779 ATGTTTTACTATAAAAACTTGGG + Exonic
943118649 2:183706985-183707007 ATGTTTTTCTTTAATATCTTGGG - Intergenic
943225072 2:185162617-185162639 ATTTTCTCCTTCAATGAGTTTGG + Intergenic
943728031 2:191272346-191272368 ATGTTCTAGTTTCAAAACTTTGG - Intronic
943752110 2:191520145-191520167 ACTTTCTCCTTTATTCACTTCGG + Intergenic
943937012 2:193932586-193932608 ATGTTATTCTTTCAGAACTTTGG + Intergenic
944626451 2:201574228-201574250 ATGTTCTCCTATGGAAACTTTGG - Exonic
946102032 2:217333743-217333765 ATGGGCTCCTTTAAAAACCTAGG + Intronic
946827564 2:223694660-223694682 ATTTTCTCATTTAATTAGTTGGG + Intergenic
947075927 2:226345964-226345986 ATCTTCTGCTTTAATAGGTTAGG - Intergenic
1169683221 20:8240821-8240843 ATTTTCTTCTTTTATAAATTTGG - Intronic
1169965978 20:11218008-11218030 AGGTTATGGTTTAATAACTTTGG + Intergenic
1171534618 20:25876130-25876152 ATGCTCTCCTTTATTCACATGGG + Intergenic
1172408880 20:34708327-34708349 TTTTTCTCATTCAATAACTTTGG + Intronic
1174468385 20:50735363-50735385 ATGATGTCCTTTAATAACCCTGG + Intronic
1177650014 21:23948601-23948623 ATGTTCTGCTTTAAAAAATGTGG + Intergenic
1178580538 21:33834487-33834509 ATTTTCTCATTAAATATCTTAGG + Intronic
1184064608 22:42110575-42110597 TTTTTCTCCTTTAATTGCTTGGG + Intergenic
1185107092 22:48878750-48878772 TTGTTCTCTTTTATTGACTTAGG + Intergenic
949198396 3:1341148-1341170 GTGTTCTCCTCTAGTAACTTTGG + Intronic
949205072 3:1428242-1428264 ATGTTCTGCTTTATTATTTTAGG - Intergenic
950878533 3:16301548-16301570 ATGTTCTACTTTAATAAAACTGG - Intronic
951382320 3:21998665-21998687 ATGTTCTTGTTTATTAACATAGG - Intronic
951989591 3:28662014-28662036 CTGTTCTCCTTTAATGACAGGGG + Intergenic
954771741 3:52976519-52976541 ATGTTTTCTTTTAATTTCTTTGG - Intronic
955067975 3:55548711-55548733 TTTTTCTACTTTAATAACGTGGG + Intronic
955335068 3:58078654-58078676 ATGGTTTCCTTTAATCTCTTTGG + Intronic
955517361 3:59740231-59740253 ATTTTCTCCTTTATTAACCCAGG + Intergenic
957566367 3:81889296-81889318 ATGTTCTCATTTATGAAATTAGG - Intergenic
958541260 3:95476587-95476609 ATTTTGTCCTTTAAAAACCTTGG - Intergenic
958837761 3:99166289-99166311 TTATTTTCCTTTACTAACTTTGG - Intergenic
959589874 3:108067055-108067077 GTGTTCTTCTTGCATAACTTTGG - Intronic
960916288 3:122698297-122698319 ATGTGCTCCAATAACAACTTGGG - Intronic
961840032 3:129702117-129702139 ATGTTTACCTTTAATAAAGTTGG + Intronic
963685298 3:148425922-148425944 ATGTTTTCATTTAATTACCTGGG - Intergenic
964507983 3:157420434-157420456 ATTTTCTCTTTTAATTACTTTGG + Intronic
965607974 3:170515513-170515535 ATTTTCTCCTTGTATGACTTGGG - Intronic
965795933 3:172438633-172438655 ATGTTTTCCTTTACTAATATTGG + Intergenic
966101445 3:176273934-176273956 ATGTGCTGCTTTAATAATTAGGG - Intergenic
967526308 3:190497858-190497880 ATGTCTTCCTTTAAGAACTAGGG - Intergenic
967581460 3:191160708-191160730 ATATTCTCCTATATCAACTTAGG - Intergenic
968259569 3:197309276-197309298 AAGTTCTCCATTAATAAAGTTGG + Intergenic
970072598 4:12178164-12178186 ATCTTCTCCTTTCCTCACTTTGG - Intergenic
970879431 4:20910967-20910989 ATCTTCACCTTTAATAATCTGGG + Intronic
971033972 4:22672949-22672971 ATTTTCTCCATTAAAAACTAAGG - Intergenic
971048306 4:22831051-22831073 ATGCTCTCCTTTAGTTATTTTGG - Intergenic
971719328 4:30225300-30225322 ATGTTCATCTTTCAAAACTTTGG + Intergenic
972146877 4:36038955-36038977 ATTTTCTCCTTTAATGAGGTAGG - Intronic
972151579 4:36097988-36098010 CTGTTCTGCTTAAATAAATTTGG - Intronic
972213449 4:36866897-36866919 ATGTTCCCCTTATTTAACTTAGG + Intergenic
973320966 4:48809825-48809847 ATGTTTTCCTCTAATAACCTAGG + Intronic
974098983 4:57396192-57396214 ATTTTCTCCCCTAATAAATTTGG - Intergenic
974743960 4:66045377-66045399 ATGTCTTCCATTAATATCTTAGG + Intergenic
974908800 4:68089766-68089788 CTGATCTCCTTTAATAAAATAGG - Intronic
975448903 4:74501246-74501268 GTGTTCTCCTTTAGTTATTTCGG + Intergenic
975791560 4:77958401-77958423 TTGATCTTCTTTCATAACTTTGG + Intergenic
976805282 4:89039320-89039342 ATGTTTTTCTTTAATAAATGGGG - Intronic
976850401 4:89538556-89538578 AGGTTCACCTTGAATCACTTTGG + Intergenic
976979870 4:91214117-91214139 CTGCTCTTCTTTAATAACTCTGG - Intronic
977148225 4:93474073-93474095 ATTTTCTTTTTTAATTACTTAGG - Intronic
977173654 4:93793323-93793345 ATGTTTTTCTTTAATCTCTTAGG - Intergenic
977475217 4:97498866-97498888 TTGTACTCCTTTCATAATTTGGG - Intronic
977836912 4:101656085-101656107 ATTTACTCCTTTAACTACTTGGG + Intronic
979386564 4:120072588-120072610 ATTTTCTACTTTGATTACTTAGG + Intergenic
979866730 4:125764640-125764662 ATGTTCTCTGTGAATAACTGAGG + Intergenic
981527766 4:145723405-145723427 CTGTTTTCCTTTAATATGTTGGG - Intronic
981982928 4:150817551-150817573 ATTTTCTGCTTTAATACTTTTGG - Intronic
986917180 5:12635271-12635293 TTGTTTTCCTTTAAAAACTTTGG - Intergenic
987564661 5:19568562-19568584 ATTTTCTCCTTTAGTCAGTTTGG - Intronic
987576464 5:19734654-19734676 ATGTTCTCCTTTAATGTTTAGGG + Intronic
988657149 5:33225070-33225092 ATGCTGTGCTTTAATACCTTGGG - Intergenic
988686633 5:33531472-33531494 ATGTATTCTTTTAATAACTGAGG + Intronic
988786193 5:34567524-34567546 ATGTTCTACTTAAATAAATGAGG + Intergenic
989726422 5:44591934-44591956 ATGTTCACATTAAATAAGTTAGG + Intergenic
990519887 5:56568998-56569020 TTGTTCTCCTTTAATCACTGGGG - Intronic
991251938 5:64572571-64572593 ATATTGTCCTTTAATGTCTTGGG - Intronic
991326980 5:65444753-65444775 GTGGTATCCTTTAATAACGTTGG - Intronic
991618442 5:68520310-68520332 AAATTCTGCTTTAATAGCTTTGG - Intergenic
992874423 5:81039293-81039315 ATGTTCTCTTTTTATATTTTAGG - Intronic
993718960 5:91303268-91303290 ATGTTTTCCTTTCATTAATTAGG + Intergenic
997032035 5:130141496-130141518 TTGTTCTCCTTTACTTACTCTGG - Intronic
997192904 5:131955722-131955744 AAGTTCTACTTAAATAAGTTTGG + Intronic
998285364 5:140855292-140855314 ATGTTCCAATTTTATAACTTTGG - Intronic
998523475 5:142821212-142821234 ATGCACTCCTTTGATCACTTTGG - Intronic
998713881 5:144858505-144858527 ATGTTCTCATCTTATAACTGTGG - Intergenic
998945286 5:147332673-147332695 ATGTTCTCTTTTTCTAACTCTGG + Intronic
999022518 5:148183637-148183659 ATGTTTTCTTCTAAGAACTTTGG + Intergenic
1000695810 5:164381532-164381554 ATTTTTTCCTTTACTAATTTTGG + Intergenic
1000733367 5:164865490-164865512 ATATTCTCTTTTATTAATTTAGG + Intergenic
1000995443 5:167953736-167953758 ATTTTAAACTTTAATAACTTAGG + Intronic
1001913019 5:175536590-175536612 TTGATCTACTTTAATAACTTTGG + Intergenic
1003315096 6:5004396-5004418 ATGTTTTCCTTTTATAACGGTGG - Intergenic
1003524901 6:6889487-6889509 ATTTTCTCTTTTAAAAACTATGG - Intergenic
1005045680 6:21640273-21640295 ACGTTGTCCTTTATCAACTTTGG + Intergenic
1005588479 6:27300333-27300355 ATTATTGCCTTTAATAACTTTGG + Intronic
1007978613 6:46127798-46127820 ACTGTCTCCTTTAATCACTTTGG - Intergenic
1008574169 6:52843669-52843691 ATGTTGTACTTTCCTAACTTGGG + Intronic
1009617262 6:66025665-66025687 CTTTTCTCCTTTAAAAACCTTGG - Intergenic
1009660173 6:66601338-66601360 ATGTAGGCCTTTAAGAACTTTGG + Intergenic
1010915301 6:81609571-81609593 ATGTTCATCTATAATAAATTGGG - Intronic
1010972348 6:82276274-82276296 ATGTTCTCCTTTATAAAATAGGG - Intergenic
1011185383 6:84669927-84669949 ATTTTCTCCATTACTAACTGGGG - Intergenic
1011692153 6:89879999-89880021 ATTTTCTCCTTTATTAAATGTGG + Intergenic
1012708712 6:102570200-102570222 ATGTTCATTTTGAATAACTTGGG - Intergenic
1013870024 6:114745991-114746013 AAGTTCCCCTTTAATTACTCAGG + Intergenic
1015431547 6:133136165-133136187 AAATTCTTATTTAATAACTTGGG + Intergenic
1015621351 6:135135313-135135335 ATGTTTTTATTTATTAACTTTGG + Intergenic
1017264519 6:152426823-152426845 ATGTTCTCCTTCCTTGACTTGGG - Intronic
1018590106 6:165410225-165410247 AAGTTCACCTTTAATATTTTAGG - Intronic
1020457784 7:8394117-8394139 CTATTGTCCTTTAAAAACTTAGG + Intergenic
1020860027 7:13480577-13480599 ATTGCCTCCTTTAAGAACTTTGG + Intergenic
1021476751 7:21070347-21070369 TTGTTTTACTTTAATAACTAGGG + Intergenic
1021708145 7:23388325-23388347 ACTTTCTCCTTTATCAACTTAGG + Intronic
1022440438 7:30428699-30428721 ATGTCCTCCTTTCATGACTGGGG - Intronic
1023585149 7:41721975-41721997 TTGTTCACCTTTCATAACTTTGG + Intergenic
1024226995 7:47332992-47333014 ATGTTCTCGTTTGCTCACTTTGG - Intronic
1024803330 7:53106940-53106962 ATGCTCACTTCTAATAACTTTGG - Intergenic
1027553414 7:79631348-79631370 ATGTTTTCCTTTGACAAGTTTGG + Intergenic
1027640023 7:80721767-80721789 CAATTCTCCTTTGATAACTTTGG + Intergenic
1028620136 7:92816313-92816335 ATGTTTTCCTTTAAGGCCTTGGG - Intronic
1030775451 7:113529548-113529570 ATGTTCTCCTTTAGTTATTTTGG - Intergenic
1031199048 7:118654433-118654455 ATGTACTCCTTTAAAATGTTAGG + Intergenic
1031891834 7:127303313-127303335 ATGTTCTCCTATTATAGCCTGGG - Intergenic
1032044971 7:128597776-128597798 ATGTTCTATTTTCATAATTTAGG - Intergenic
1032294958 7:130628285-130628307 CTTTTTTCCTTTAATAACTTTGG + Intronic
1032950874 7:136910563-136910585 ATGTCCTCCCTTAATAAATATGG - Intronic
1033179549 7:139162587-139162609 ATGTACTAGTTTTATAACTTTGG + Intronic
1034909147 7:154978601-154978623 ATATTTTCCTAAAATAACTTGGG - Intronic
1035193325 7:157191702-157191724 ATCTTATACTTTAATAATTTGGG + Intronic
1036492616 8:9241913-9241935 ATGCTTTCCTTTCTTAACTTTGG - Intergenic
1037395576 8:18438364-18438386 ATGTTTTCCTTGCATACCTTTGG + Intergenic
1038263152 8:26015513-26015535 TTGTTTGCCTTCAATAACTTGGG + Intronic
1038357614 8:26844287-26844309 AAGTTCTCGATTAATAATTTGGG - Intronic
1038616791 8:29102919-29102941 AATTTCTCCTAAAATAACTTTGG + Intronic
1039252782 8:35684849-35684871 ATGTTCTATTCTAAGAACTTGGG - Intronic
1040600262 8:48876961-48876983 ATATTATCTTTTAATAATTTAGG + Intergenic
1041977076 8:63812032-63812054 TTATTATCCTTTAATAAGTTGGG - Intergenic
1042340291 8:67671772-67671794 ATGTACTCCCAAAATAACTTTGG + Intronic
1043268129 8:78292391-78292413 ATTTTCTCCATCAATAAATTTGG - Intergenic
1043757716 8:84024305-84024327 ATTTTATCCTTAAATAATTTTGG + Intergenic
1044502982 8:92982982-92983004 ATGTTCTCATTTATGAAATTAGG + Intronic
1048941923 8:139407325-139407347 ATTATCTCATTTAATAATTTGGG + Intergenic
1050316728 9:4409361-4409383 ATGTTCTCCATTTTTTACTTAGG + Intergenic
1052164805 9:25312262-25312284 ATGTCCACCTTTAATCACTGAGG - Intergenic
1054551502 9:66608326-66608348 ATGTTCTCTTATTATTACTTTGG + Intergenic
1054858853 9:69929359-69929381 CCTTTCTCCTTTAATTACTTGGG + Intergenic
1055909209 9:81327690-81327712 GTGATCTCCTTTAATTATTTTGG + Intergenic
1056994878 9:91446358-91446380 GTGTTCTCCTTTAGTTATTTTGG + Intergenic
1057475159 9:95393704-95393726 ATTTTCTCATTTAAAAAATTGGG + Intergenic
1058510220 9:105710394-105710416 ATCTCCTTCTTTCATAACTTCGG + Intronic
1059458452 9:114414510-114414532 AAGTTCCCCTTTGATAGCTTGGG + Intronic
1059678374 9:116562377-116562399 ATGTTCTCCTGTGTGAACTTTGG + Intronic
1061523377 9:131136622-131136644 ATGTTTTTCTTTCATAACTGAGG - Intronic
1186010729 X:5129388-5129410 ATGTTCTCCTTTATTTGCTGTGG - Intergenic
1186074339 X:5861204-5861226 ATGATCACCTTTAAAAAATTAGG + Intronic
1187699305 X:21949528-21949550 AAATTCTGCTTTAATCACTTAGG - Intronic
1188091477 X:25969662-25969684 ATGTTGTCCTTTCAAATCTTGGG - Intergenic
1189629115 X:42933206-42933228 ATGTTCTACTTCAATTATTTTGG - Intergenic
1190730404 X:53222021-53222043 ATGTTCTCATTTTATAAATGGGG + Intronic
1190884142 X:54516357-54516379 TTCTTCTCCTTCAGTAACTTTGG + Intergenic
1192850542 X:74951400-74951422 ATGGTATTCTTTAATAAATTGGG + Intergenic
1193046193 X:77057320-77057342 ATGTTATCATTTAATAACTAGGG + Intergenic
1194866364 X:99073519-99073541 ATTTTCCCCTTTAGAAACTTTGG - Intergenic
1195796949 X:108660763-108660785 TTGTTATTTTTTAATAACTTTGG + Intronic
1196205723 X:112937196-112937218 ATGTTATCATGTAATTACTTGGG - Intergenic
1196907263 X:120449755-120449777 ATTTTCTGCTTTAAAAACTGAGG - Intronic
1197494245 X:127157619-127157641 ATGTTTTCTTTTTATACCTTGGG - Intergenic
1197971078 X:132115649-132115671 TTTTTCTCCTTTAATTGCTTAGG + Intronic
1199080102 X:143567597-143567619 ATGTTCTCTTTGTATATCTTGGG + Intergenic