ID: 1078325983

View in Genome Browser
Species Human (GRCh38)
Location 11:10381128-10381150
Sequence GTTGCTCTTGACTGAAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078325983_1078325989 7 Left 1078325983 11:10381128-10381150 CCAGAGCTTCAGTCAAGAGCAAC 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1078325989 11:10381158-10381180 GTGGTTAGAAGTTGGGCTGGTGG 0: 1
1: 0
2: 1
3: 25
4: 200
1078325983_1078325991 18 Left 1078325983 11:10381128-10381150 CCAGAGCTTCAGTCAAGAGCAAC 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1078325991 11:10381169-10381191 TTGGGCTGGTGGGTCTGAAATGG 0: 1
1: 0
2: 1
3: 19
4: 219
1078325983_1078325988 4 Left 1078325983 11:10381128-10381150 CCAGAGCTTCAGTCAAGAGCAAC 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1078325988 11:10381155-10381177 GTGGTGGTTAGAAGTTGGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 210
1078325983_1078325992 30 Left 1078325983 11:10381128-10381150 CCAGAGCTTCAGTCAAGAGCAAC 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1078325992 11:10381181-10381203 GTCTGAAATGGATAGTGCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 160
1078325983_1078325990 8 Left 1078325983 11:10381128-10381150 CCAGAGCTTCAGTCAAGAGCAAC 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1078325990 11:10381159-10381181 TGGTTAGAAGTTGGGCTGGTGGG 0: 1
1: 0
2: 4
3: 18
4: 184
1078325983_1078325987 0 Left 1078325983 11:10381128-10381150 CCAGAGCTTCAGTCAAGAGCAAC 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1078325987 11:10381151-10381173 AGATGTGGTGGTTAGAAGTTGGG 0: 1
1: 0
2: 0
3: 20
4: 219
1078325983_1078325986 -1 Left 1078325983 11:10381128-10381150 CCAGAGCTTCAGTCAAGAGCAAC 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1078325986 11:10381150-10381172 CAGATGTGGTGGTTAGAAGTTGG 0: 1
1: 0
2: 1
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078325983 Original CRISPR GTTGCTCTTGACTGAAGCTC TGG (reversed) Intronic
902230431 1:15023930-15023952 GTTGCTCTGGCCTTAAACTCTGG - Intronic
904203883 1:28839967-28839989 GTTGCTCATTACTGAGGATCAGG + Intronic
906542977 1:46602440-46602462 GTTTATTTTGACTGAAGCACAGG + Intronic
907320122 1:53596725-53596747 GTACCTCATGACTGGAGCTCGGG - Intronic
907328993 1:53659200-53659222 CCTGCTCTTGACTGGAGCTTTGG - Intronic
908968605 1:69797337-69797359 GTTATTCTAGTCTGAAGCTCAGG - Intronic
909979086 1:82077060-82077082 GGTGCTCTTCATTGAAGCTAGGG + Intergenic
910348310 1:86266475-86266497 GTTGCCCTTGCTTGAAGCTGGGG + Intergenic
910403338 1:86858459-86858481 TTTTTTCATGACTGAAGCTCGGG + Intergenic
915018680 1:152760165-152760187 GTAGCCCTTGACTGAAACTGGGG - Exonic
917768208 1:178246561-178246583 CTTTCTCTTGCCTGATGCTCTGG + Intronic
918270536 1:182894028-182894050 CTTTCTCTTGTCTGATGCTCTGG - Intergenic
1066258497 10:33705245-33705267 GGTGGCCTGGACTGAAGCTCAGG + Intergenic
1067232679 10:44423091-44423113 GATGCTCTTGACTGAAGTCTTGG - Intergenic
1070012250 10:72487530-72487552 TTTGCTCTTGACTGACCCACTGG - Intronic
1072171005 10:92861601-92861623 TTGGCTCTTGACTGAAACCCTGG + Intronic
1075897846 10:126013503-126013525 GTTGCTCTGGGCTGCAGCCCTGG + Exonic
1078325983 11:10381128-10381150 GTTGCTCTTGACTGAAGCTCTGG - Intronic
1083730045 11:64647997-64648019 ATTGCTGCTGCCTGAAGCTCTGG - Intronic
1084980941 11:72828407-72828429 GTTGGTCGTGGCTGAGGCTCAGG - Exonic
1085001695 11:73043047-73043069 CTTTCTCTTGACTGATGCTCTGG + Intronic
1089076825 11:115745188-115745210 GGTGCCCTTGCCTGAAGCTGAGG - Intergenic
1097580320 12:61447661-61447683 GTTGCTTTTGAGTAATGCTCAGG + Intergenic
1100246659 12:92765068-92765090 TATGCTCTTCACTGAAGCTCTGG - Intronic
1102874969 12:116442220-116442242 CTTGCTCTTGTCTGCATCTCCGG + Intergenic
1105597006 13:21848299-21848321 GTAGCTCTTAACATAAGCTCAGG - Intergenic
1112800912 13:103108812-103108834 GCTTCTCTGCACTGAAGCTCTGG + Intergenic
1114182520 14:20378342-20378364 GTTGCTCTTGGGGGAAGCACAGG - Intronic
1114550739 14:23531493-23531515 GCTGCCCGTGGCTGAAGCTCAGG + Exonic
1115787811 14:36846068-36846090 GTCACTCTTCACTGGAGCTCTGG - Intronic
1116562339 14:46396380-46396402 GTTGGTATTTACTGAAGCTTGGG - Intergenic
1118387032 14:65264573-65264595 GATGCCCTTGACTGAAACCCAGG - Intergenic
1120574068 14:86159010-86159032 GTTGCTCATTACTACAGCTCTGG + Intergenic
1122024713 14:98867409-98867431 GTGGCTCTTGCCAGAACCTCTGG + Intergenic
1122085349 14:99297154-99297176 GTTGATCTGGAGTGAAGCCCAGG + Intergenic
1122186082 14:99997343-99997365 GTTGTTCTTGCCTGAAGGGCAGG + Intronic
1122713773 14:103680832-103680854 GATCCTCTTGAATGAAGTTCTGG + Intronic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1123894940 15:24819224-24819246 GTTGTTCTGGAATGAAGCACTGG + Intergenic
1125468207 15:39976285-39976307 GTGGTTCTTGACTGTAGCTGTGG + Intronic
1125766133 15:42137729-42137751 GGTGCTCTTGAGAGAGGCTCTGG - Intergenic
1126365526 15:47890206-47890228 GTAAATCTTAACTGAAGCTCAGG + Intergenic
1131403816 15:92147228-92147250 ATTCCTGTTGTCTGAAGCTCTGG - Intronic
1132864547 16:2086952-2086974 GCTCCTCGTGACCGAAGCTCAGG - Intronic
1136044936 16:27608025-27608047 GCTGCTCCTGAATGCAGCTCAGG + Intronic
1138327068 16:56182952-56182974 TTTGCTCTTCACTGAAAGTCTGG - Intergenic
1140026775 16:71297976-71297998 TTTGCTCTTTACTAAATCTCTGG + Intergenic
1140608438 16:76569483-76569505 GCTGCTTCTGGCTGAAGCTCAGG + Intronic
1141495264 16:84405376-84405398 TTTGCTCATGACTGATGCTCAGG - Intronic
1156652367 18:39239363-39239385 GTTGCTCTTTACTCCAGCTGTGG - Intergenic
1163016625 19:14459760-14459782 CTTTCTCTTGACTGTGGCTCTGG - Intronic
1163374990 19:16924536-16924558 GTTGCTCTAGGCTGAAAGTCTGG - Intronic
1166293432 19:41877672-41877694 GTTGCTCTTGACTGAGCACCAGG + Intronic
1166639743 19:44485578-44485600 GTTGCTAATGACTCCAGCTCTGG + Intronic
1168096487 19:54118409-54118431 GATGGTCTTGACTGAATCCCCGG - Exonic
925197490 2:1937987-1938009 ATTACTCTTTACTGAATCTCAGG - Intronic
927066929 2:19480977-19480999 GGTCCTCTTGACTGATGCTCAGG + Intergenic
927417351 2:22892891-22892913 GTTGCTGTTAACTGGAGCTTTGG + Intergenic
931537860 2:63298768-63298790 GTTGCACTTGGCTGCAGCCCTGG + Intronic
933918675 2:87022626-87022648 GTTGCTCTAGACTTAAGCCAGGG - Intergenic
934004320 2:87747289-87747311 GTTGCTCTAGACTTAAGCCAGGG + Intergenic
934939269 2:98488762-98488784 GTTGCTTGAGACTGAAGTTCAGG + Intronic
935672231 2:105565663-105565685 GATGCCCTTCACTGAAGCCCGGG - Intergenic
935767281 2:106381303-106381325 GTTGCTCTAGACTTAAGCCAGGG + Intergenic
941105877 2:161352255-161352277 ATTGCTCTGGATTGAGGCTCAGG - Intronic
943056904 2:182993315-182993337 TTGGCTGTTGACTGAATCTCTGG + Intronic
943275518 2:185862805-185862827 GTTGTTCTTACCTGATGCTCTGG - Intergenic
944159757 2:196645726-196645748 TTTGCTCTTGCCTGAAGTTAAGG + Intronic
1174561532 20:51434034-51434056 GGGGCTCTAGACTGCAGCTCAGG - Intronic
1178630067 21:34251838-34251860 GTTGGTCTGGAGTGAAGCCCGGG + Intergenic
1180791851 22:18578893-18578915 TTTGATCTTGACTGGAGCTGGGG - Intergenic
1181229885 22:21416416-21416438 TTTGATCTTGACTGGAGCTGGGG + Intergenic
1181248764 22:21518450-21518472 TTTGATCTTGACTGGAGCTGGGG - Intergenic
1182037159 22:27208010-27208032 GTGGCTTTTGACTGAAGCCAGGG - Intergenic
1182316286 22:29449475-29449497 GTAGCTCTTACCTGAAGCCCAGG + Intergenic
1182554960 22:31124235-31124257 CTTGCTCCTGAGTGGAGCTCTGG + Intronic
1182803607 22:33052137-33052159 CTAGCTCTAGACTGAAGGTCAGG - Intronic
949574300 3:5323830-5323852 AGTGCTCTTGAGTGAATCTCTGG - Intergenic
950874692 3:16261066-16261088 GTTGCTCTGAACTGAAGATAGGG - Intronic
955182152 3:56682787-56682809 GCTGCTCGTGGCTGAGGCTCTGG + Exonic
956307753 3:67845088-67845110 GCTGCTCATGACAGAGGCTCAGG + Intergenic
959279155 3:104316265-104316287 GTTGCTGTGGAGTGCAGCTCTGG + Intergenic
964456277 3:156870670-156870692 CTTTCTCTTGCCTGATGCTCTGG + Intronic
965955448 3:174363546-174363568 GTTCTGCTTGGCTGAAGCTCAGG - Intergenic
967939997 3:194758297-194758319 GTTGCGTATGTCTGAAGCTCGGG - Intergenic
969886929 4:10223255-10223277 GCTACCCTTGACTGAAGCTCTGG + Intergenic
969977561 4:11119565-11119587 GTTGCTCTTGAAGTAAACTCTGG - Intergenic
970745217 4:19286191-19286213 TTTGCTATTCACTGATGCTCTGG + Intergenic
978937139 4:114391496-114391518 GCTGCTCTTGAATGGAGATCAGG + Intergenic
979530309 4:121763841-121763863 GCTGCCCTTGACTGGTGCTCAGG - Exonic
988398546 5:30730498-30730520 GTTGCTATTGACTTAATTTCTGG + Intergenic
988596495 5:32597007-32597029 GTTGTTATTGACTGGAACTCTGG + Intronic
992654056 5:78890764-78890786 GTTCTACGTGACTGAAGCTCAGG - Intronic
993482414 5:88440166-88440188 GTTTCTCTTCTCTGTAGCTCTGG + Intergenic
995410151 5:111848017-111848039 GTTGAGTTTTACTGAAGCTCAGG - Intronic
995838234 5:116419503-116419525 GCTGCACTTGACTCAAGCTGTGG - Intergenic
998404169 5:141864299-141864321 GTTGCTCTCGATCAAAGCTCAGG + Exonic
998582096 5:143387190-143387212 CTTACTCTTAACTGAATCTCAGG + Intronic
1000550964 5:162663977-162663999 ATTGCACCTGACTGAAGCTGAGG + Intergenic
1001894294 5:175365290-175365312 ATTTCTCTTCACTGAAGCTAAGG - Intergenic
1004666051 6:17749565-17749587 GTAGCTCTTGACTAAAGATTGGG - Intergenic
1004761772 6:18674863-18674885 GTTGCTCTTCACTGGAGTGCTGG + Intergenic
1008887269 6:56444772-56444794 CTTGCTCTAGACTCCAGCTCAGG + Intergenic
1009408204 6:63334119-63334141 CTTTCTTTTGACTGATGCTCTGG - Intergenic
1011621393 6:89246289-89246311 GTTACTCGTGAACGAAGCTCAGG - Intergenic
1017884232 6:158586001-158586023 GTCACTCTTGACTGAGGCTTTGG + Intronic
1018128106 6:160701435-160701457 GTTGCTCTAGACTTAAGCCAGGG + Intergenic
1018177132 6:161186742-161186764 GTTGCTCTGGGCTTTAGCTCAGG - Intronic
1018814206 6:167318635-167318657 GTTGAGCTTGACGGAAGGTCTGG + Intergenic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1021614150 7:22485845-22485867 GTTCCTCTTGAATCAAACTCTGG - Intronic
1022001026 7:26226114-26226136 GTTTCTCTTGACTGACACTTGGG - Intergenic
1023599207 7:41865021-41865043 GCTGCTCTTGACTTATGCTTCGG + Intergenic
1023881007 7:44321439-44321461 GATGCCCTAGACTGGAGCTCAGG + Intronic
1024512144 7:50212730-50212752 GTTGCTCTTCACTGAATATATGG - Intergenic
1030065260 7:105654489-105654511 GGTGCTCTTTACTGTAGCACTGG + Intronic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1037709471 8:21344023-21344045 TTTGCTCTGGTCTGAAGCACGGG - Intergenic
1039296093 8:36156702-36156724 TTTCCTCTTCACTGAAACTCTGG - Intergenic
1039824783 8:41163835-41163857 GTTGTCCTTGTCTGAAGATCAGG - Intergenic
1042667009 8:71218187-71218209 GTTCTTTTTGACTGAAGGTCTGG + Intronic
1047000529 8:120568429-120568451 GTTGATCAGGACTGATGCTCTGG + Intronic
1049832368 8:144710116-144710138 GTTGCTCTTCTCTGCACCTCAGG - Intergenic
1050927331 9:11280931-11280953 GTTGCAATTGCCTGAAGGTCAGG - Intergenic
1051842859 9:21417990-21418012 GTTGCTCTTCTGTGAGGCTCTGG + Intronic
1056094889 9:83242856-83242878 GATGCTCCTGGCTGAACCTCAGG - Intergenic
1056119344 9:83471864-83471886 GTTGATCTGGACTCCAGCTCTGG + Intronic
1056779844 9:89541160-89541182 GGTCCACTTGACTGAACCTCAGG - Intergenic
1057037267 9:91820500-91820522 GTGGCTCCTGACTGTAGATCTGG - Intronic
1185576230 X:1174763-1174785 GTTACTCGTGACTGGACCTCTGG + Intergenic
1186485436 X:9931131-9931153 GTTGCTGTTGTCTGAAGCTGAGG + Intronic
1186948656 X:14597479-14597501 TTTGATCTTGACTAAATCTCTGG - Intronic
1187241582 X:17518807-17518829 GTTGATCTTGAGTGCAGCTTGGG + Intronic
1187679668 X:21754598-21754620 GCTGCTCTTGGCAGAAGGTCAGG - Intronic
1190339217 X:49283104-49283126 GTTGATATTTACTGAAGCTGGGG - Intronic
1190744982 X:53317192-53317214 GTTGGTCCTGACTAATGCTCAGG - Intronic
1199310615 X:146315772-146315794 GTAGCTCTTGAATGAAGTTGAGG - Intergenic
1201256736 Y:12115053-12115075 GTGGCTCGTGACTGAAGTCCAGG + Intergenic