ID: 1078333742

View in Genome Browser
Species Human (GRCh38)
Location 11:10447320-10447342
Sequence GAGTTAATACAGAGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078333741_1078333742 -6 Left 1078333741 11:10447303-10447325 CCATGGTTAAAGTGACTGAGTTA 0: 1
1: 0
2: 2
3: 2
4: 135
Right 1078333742 11:10447320-10447342 GAGTTAATACAGAGAGAAGATGG 0: 1
1: 0
2: 2
3: 41
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078333742 Original CRISPR GAGTTAATACAGAGAGAAGA TGG Intronic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
903286183 1:22278179-22278201 GAGATAAAAGAGAGAGAGGAAGG + Intergenic
904917188 1:33978593-33978615 GAGTTAATCCAGAGAAGAGAGGG + Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905383413 1:37581071-37581093 AAGTACATACAGAGAGAGGATGG + Intronic
906546615 1:46623960-46623982 GAGTTGAAAAAGAGATAAGAAGG + Intergenic
907943187 1:59108340-59108362 AAGTTACTCAAGAGAGAAGAGGG + Intergenic
908210962 1:61899584-61899606 GAGTTACCTGAGAGAGAAGAAGG + Exonic
908415487 1:63909232-63909254 AAGTTAAAAAAGAGAAAAGAAGG - Intronic
908547402 1:65175348-65175370 GAGTTACTACAGAGAGAGAGAGG + Intronic
909379655 1:74984012-74984034 GAGGTAGTAGAGAGGGAAGATGG - Intergenic
910313103 1:85850026-85850048 AAGGAAATACAGAGAGAAAAAGG + Intronic
910354701 1:86341448-86341470 CAGTTAAACCAGAGAGAAAAAGG - Intergenic
910489141 1:87748771-87748793 GAGGTAATACAGAGAGTAAATGG + Intergenic
910691562 1:89970684-89970706 ATGTAAAGACAGAGAGAAGATGG + Intergenic
910795978 1:91098395-91098417 GAGATGATACAGAGAGAGAATGG + Intergenic
910877813 1:91894053-91894075 GAGTTCAAAGAGGGAGAAGAAGG - Intronic
910975298 1:92900213-92900235 GAGTTCAGAAAGAGAAAAGAAGG - Intronic
911381243 1:97117518-97117540 AAGTTAATACAGAGACAATTAGG + Intronic
911641752 1:100297373-100297395 TAGCTATTACAGAGAGATGATGG - Intergenic
912164963 1:107032137-107032159 GAATGAGTATAGAGAGAAGAAGG - Intergenic
912839908 1:113030242-113030264 AAGTAAAAACAAAGAGAAGAAGG - Intergenic
913066032 1:115255861-115255883 GAGTTGCTACAGAGAAAATATGG + Intergenic
913458716 1:119060897-119060919 GAGTTAATACATAGAATATAAGG - Intronic
913690220 1:121272541-121272563 GAGTTAAGACAGCGAGAATGAGG + Intronic
914147320 1:145007418-145007440 GAGTTAAGACAGTGAGAATGAGG - Intronic
914238325 1:145832721-145832743 GAGTTAAAATAGAGAGAGAAAGG + Intronic
915859601 1:159430080-159430102 GAGATAAAAGAGAGAGATGAGGG - Intergenic
916096972 1:161360052-161360074 GAGTCAGTTCAGAGAAAAGATGG - Intronic
916485092 1:165251517-165251539 GAGGTAAGACAGAAAGAAGGGGG + Intronic
918112521 1:181469648-181469670 GAGTGCATACATAGTGAAGAAGG + Intronic
919414105 1:197285299-197285321 GAGTGAAAATAGAGAGATGATGG + Intronic
919424871 1:197417496-197417518 GAGTTGATAAAGAAGGAAGAAGG + Intronic
919915866 1:202138724-202138746 CAGTTACTACAGAGAGATGTAGG - Intronic
919929566 1:202212612-202212634 GAGCTCACACACAGAGAAGAAGG - Intronic
919944883 1:202311883-202311905 GTGTTAATACATTGGGAAGAAGG - Intronic
920334605 1:205236297-205236319 AAGATAATAGAGTGAGAAGAGGG + Intronic
920477540 1:206291028-206291050 GAGTTAAGACAGCGAGAATGAGG + Intronic
921378050 1:214494361-214494383 GAGGTAAGAAAGAGAGAGGAGGG - Intronic
923192607 1:231634345-231634367 AAGTAAATACAGAGATAAAACGG + Intronic
923744196 1:236686033-236686055 GAGATGAGAGAGAGAGAAGAGGG + Intergenic
924354373 1:243154764-243154786 GTTGTAATACAAAGAGAAGAGGG - Intronic
924542819 1:244997325-244997347 TAGTTAAGACAGAGATGAGAGGG - Intronic
1063005081 10:1962521-1962543 GAGTCAATTCACAGAGAGGAAGG - Intergenic
1063384249 10:5606224-5606246 GAGTTTATACAGAGAGAGACAGG - Intergenic
1063502829 10:6570401-6570423 CACTTAATACAGAGAGAATGGGG + Intronic
1064247186 10:13678301-13678323 GAGTTACTTCAGGGCGAAGATGG + Intronic
1064535871 10:16357217-16357239 GAGTAAATACAAAGAGATAATGG - Intergenic
1065958482 10:30714116-30714138 TAGTGAATACACAGAGAGGATGG - Intergenic
1066577639 10:36843915-36843937 GAATTAATAGAGAAAGTAGATGG + Intergenic
1068255535 10:54504814-54504836 GAGAGAGTACAGAGAGAAAATGG - Intronic
1068459024 10:57301852-57301874 GAAATAATACAGAGAGATGTGGG - Intergenic
1068937616 10:62651249-62651271 GAGTGAAGACAAAGAGAAGGAGG - Intronic
1071293873 10:84205413-84205435 GAGGGAATAAAGAGAGGAGAGGG - Intronic
1071407479 10:85352134-85352156 GGGGTAATAAACAGAGAAGAGGG - Intergenic
1071865546 10:89726500-89726522 GAGTTAAAAAAGAGAGAAAATGG + Exonic
1071954027 10:90737258-90737280 GAGGTGATGCAGAGTGAAGAGGG - Intergenic
1072058329 10:91783108-91783130 GAGTTAAAACAGAAATAAGAAGG - Intergenic
1073047682 10:100650427-100650449 GGGTAAAGACAGAGAGGAGAAGG + Intergenic
1073959083 10:108905142-108905164 GAGTAAAAACAGAGAGAAGAGGG + Intergenic
1075169689 10:120101856-120101878 GAGAGAATCCAGAGAGAGGATGG + Intergenic
1075942221 10:126400281-126400303 GAGATATGACAGAGAGAAAAAGG + Intergenic
1077934993 11:6774228-6774250 GAGTAAAGGCAGAGAGAATAGGG - Intergenic
1078333742 11:10447320-10447342 GAGTTAATACAGAGAGAAGATGG + Intronic
1078923161 11:15850269-15850291 GAGTAATTACAGAAAGAAGGGGG + Intergenic
1079027438 11:16960388-16960410 GAGTAAATACAGGGAGAATTTGG - Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1080120864 11:28675615-28675637 CAGGTAATACAGTGAGAAGTGGG - Intergenic
1080308413 11:30861828-30861850 AAGTTCAAACAGAGAGCAGACGG + Intronic
1081510333 11:43765790-43765812 ATTTTAATACAGAGAGAAAAAGG - Intronic
1081698746 11:45138204-45138226 CAGGTAATACAGAGAACAGAAGG + Intronic
1084940405 11:72609602-72609624 AAGTTAATAGAGCGAGAAGCAGG - Intronic
1085115447 11:73927577-73927599 GAGTTTATACAAGGAGAAGTTGG - Exonic
1085337301 11:75705991-75706013 GGGCAAATAAAGAGAGAAGAAGG + Intergenic
1085834152 11:79934513-79934535 GGTTTGCTACAGAGAGAAGAGGG + Intergenic
1085870632 11:80345454-80345476 TAGATAATATAGAGAGTAGATGG - Intergenic
1086092158 11:83015666-83015688 GAGTGGATAAATAGAGAAGAGGG + Intronic
1087164853 11:94991755-94991777 GAGTTAATACACAGACGAAAAGG + Intronic
1087290391 11:96314579-96314601 GAGTTGAAACAAAGAGAAGGAGG - Intronic
1087823043 11:102732768-102732790 CAATTAAGACAGAGAGATGAAGG - Intergenic
1087836438 11:102879883-102879905 GAGTTAATACTGAGAGTGGTGGG + Intergenic
1088235905 11:107722239-107722261 GAATTCATACTAAGAGAAGAAGG - Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088837532 11:113590515-113590537 ATTTTAATACAGGGAGAAGAAGG + Intergenic
1089571294 11:119412309-119412331 GAGTTAAAACAGAGAGGACTGGG - Intergenic
1089942494 11:122433434-122433456 ATGGGAATACAGAGAGAAGAGGG + Intergenic
1091770716 12:3149391-3149413 CAGGTAAAAAAGAGAGAAGAAGG - Intronic
1092056026 12:5508631-5508653 GTGGTAACACAGGGAGAAGATGG + Intronic
1093790435 12:23243948-23243970 AAGGTAAGAGAGAGAGAAGAAGG - Intergenic
1093823265 12:23648600-23648622 GTGTGAACACAGAGAGAAGGTGG + Intronic
1093993364 12:25614884-25614906 GTGTGAAAACAGGGAGAAGATGG - Intronic
1096280958 12:50253137-50253159 CAGTAAATATAGAAAGAAGAGGG + Intronic
1096852250 12:54448032-54448054 GAGTTAATTTAAAGAGAAGAGGG + Intergenic
1097665682 12:62474848-62474870 CAGTGAATAAAGAGAGATGAGGG - Intronic
1098205494 12:68104957-68104979 TAGTCAATACAGAGAGAAGCAGG - Intergenic
1098237940 12:68436109-68436131 GACTTAAAACAGAAAGAAGCAGG + Intergenic
1098489004 12:71053264-71053286 GAATTAATCCACAGAGAATAAGG - Intronic
1098499470 12:71174007-71174029 GAATTTCTAGAGAGAGAAGATGG + Intronic
1098627160 12:72686014-72686036 GTTTGAATACAGAGAGAACAGGG + Intergenic
1098689315 12:73466641-73466663 GGGAAAACACAGAGAGAAGATGG + Intergenic
1099256356 12:80318246-80318268 GAGGTAAAACTGGGAGAAGAGGG + Intronic
1099536211 12:83848208-83848230 AAGGAAACACAGAGAGAAGAAGG - Intergenic
1100068324 12:90679149-90679171 AAGTGAACACAGAGAGAAGATGG - Intergenic
1100232655 12:92624646-92624668 GAATTAGGACAGAGAGAAGATGG - Intergenic
1100707759 12:97220191-97220213 GAGATAAGACACAGAGGAGAAGG - Intergenic
1101560718 12:105855326-105855348 GAGATAAGGCAGAAAGAAGATGG + Intergenic
1101618504 12:106361064-106361086 GAGTTAAGACATGGTGAAGAGGG + Intronic
1102824219 12:115933695-115933717 GAGTGCAAACAGAGAGGAGAGGG - Intergenic
1103023158 12:117552948-117552970 GAATTAGGACAGAGAGCAGAGGG - Intronic
1104074819 12:125379675-125379697 CAGTTAATCCAGAAAGTAGATGG + Intronic
1104833973 12:131775096-131775118 GTGTTAAAACAGAGGGGAGATGG - Intronic
1105681956 13:22737095-22737117 GAATTAATACTGAAACAAGAGGG + Intergenic
1106368652 13:29109060-29109082 AAACTAATACAGAGAGAAGGTGG - Intronic
1106583035 13:31033937-31033959 TACTTAATACTGAGAGAATATGG - Intergenic
1107519781 13:41168077-41168099 GAGAGGATACAGTGAGAAGAGGG + Intergenic
1108045894 13:46384278-46384300 AAGTAAATACAGAGAGAATAGGG + Intronic
1108056852 13:46493837-46493859 GTGTTAATACAAAGATAAAAAGG + Intergenic
1109551584 13:63909426-63909448 GAGTAAATATAGAGAAAAGACGG - Intergenic
1110539893 13:76696367-76696389 GGGTTGTTACCGAGAGAAGAGGG - Intergenic
1111060653 13:83014591-83014613 GAGATAAAAAAGATAGAAGATGG + Intergenic
1111252132 13:85615425-85615447 GAGTTAAAAAAAAAAGAAGATGG - Intergenic
1112627748 13:101125290-101125312 GAGTTAAAGCAGGCAGAAGAAGG + Intronic
1113128697 13:107009982-107010004 GAGAAAATTAAGAGAGAAGAAGG + Intergenic
1114400166 14:22402726-22402748 GAGTTAAAGAAGGGAGAAGAAGG + Intergenic
1114719772 14:24868792-24868814 TAGTAAAAACAGAGAGAAAAGGG + Intronic
1115112748 14:29843221-29843243 GTGAAGATACAGAGAGAAGATGG + Intronic
1116149879 14:41127394-41127416 GAGTTACTACAGAGAAACAAAGG - Intergenic
1116175093 14:41459083-41459105 GAGTTAATCCAGACAGAACTGGG - Intergenic
1117402040 14:55367346-55367368 GAGTTCGTAGAGAGTGAAGATGG - Exonic
1118347990 14:64953666-64953688 GAGTGACAACAGAGAGATGAGGG + Intronic
1120128426 14:80775523-80775545 GTGCTAATGCAGAGAAAAGATGG - Intronic
1121398156 14:93646283-93646305 GAGTTAATATGGAGAGGAGCTGG + Intronic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1122685570 14:103503966-103503988 AAGGCAATAAAGAGAGAAGATGG + Intergenic
1123773518 15:23554021-23554043 GTGAGGATACAGAGAGAAGATGG + Intergenic
1125420577 15:39500321-39500343 GATATAACAGAGAGAGAAGAGGG + Intergenic
1125424323 15:39534030-39534052 GAGATAATACAGGCAGAACAGGG + Intergenic
1127153553 15:56104704-56104726 GCCTTAATACAGAAAGAATAAGG + Intronic
1127160519 15:56179743-56179765 GTGTTGAGACAGAGAGAGGAGGG - Intronic
1127717618 15:61664975-61664997 GAGTTAATAGGGATAGAACATGG + Intergenic
1128698363 15:69786106-69786128 GAGCTAATTCACAGAGAAGCTGG + Intergenic
1129323922 15:74789651-74789673 GAGTTAATGAAGACTGAAGAAGG - Intronic
1130032139 15:80325782-80325804 GATTCAATACAGTGAGAAAAGGG - Intergenic
1130125985 15:81094509-81094531 AGGTTAATGCAGTGAGAAGAGGG + Intronic
1130360845 15:83184286-83184308 GACTTAACACAGATAGCAGAAGG - Intronic
1131040246 15:89257917-89257939 AAGTTACTAAAGAGAAAAGAAGG - Intronic
1131833297 15:96367805-96367827 CAATTAATACGGAGAGAAGACGG + Intergenic
1131935272 15:97497372-97497394 GAGTAAATACACACAGAAGATGG + Intergenic
1132420277 15:101660026-101660048 GACTTAAGACAGAGTGGAGAAGG + Intronic
1133463566 16:6008242-6008264 GAGTGAATAAAGAGACAAGAGGG + Intergenic
1133475541 16:6118088-6118110 ATGTTAATACTCAGAGAAGATGG - Intronic
1135882553 16:26272653-26272675 GGTTTAACACAGAAAGAAGAAGG - Intergenic
1136481654 16:30545799-30545821 CAGTTAAATCAGAGAGAAAAAGG + Intronic
1136528216 16:30847011-30847033 GAGTTATTACAAAGAGAAAATGG + Intronic
1137264287 16:46856094-46856116 GAGTTAATACAATGAGACTAAGG - Intergenic
1137947557 16:52749448-52749470 GAGGGAGTATAGAGAGAAGAAGG + Intergenic
1139525906 16:67516382-67516404 AAGTAAATTCAGAGACAAGAGGG + Intergenic
1140180749 16:72715619-72715641 AAGCTAATAGATAGAGAAGATGG - Intergenic
1140497538 16:75402656-75402678 AACTTGATACAGAGAGAAAAAGG + Intronic
1141460889 16:84178297-84178319 GAGCTCATGCAGAGAGATGATGG - Exonic
1141783697 16:86183385-86183407 GATTTATTACACAGTGAAGAAGG + Intergenic
1143447528 17:7018212-7018234 GAGTTCCTACAGAGGGAAGATGG - Intergenic
1146112174 17:30099927-30099949 GAGTGAATACAGAAAAAAGAGGG - Intronic
1147539783 17:41347420-41347442 CATTTAATACAAAGAGCAGAGGG - Intronic
1147564911 17:41530018-41530040 GTGATAATACACAGAGAAGAGGG - Intergenic
1147873485 17:43604219-43604241 GAGTATATACAGAGAAAGGATGG + Intergenic
1148238943 17:45987450-45987472 CAGTTTATGCAGTGAGAAGATGG - Intronic
1149573097 17:57689321-57689343 GAGTTAATAGAAAAAGAAAAGGG + Intergenic
1150676982 17:67252665-67252687 AAATTTATACAGAGAGTAGAAGG + Intergenic
1151011286 17:70499988-70500010 GATTGAATACAGAGAGGAGAAGG - Intergenic
1152257185 17:79246902-79246924 GAGTTAATACACAGGGCAGACGG + Intronic
1153038320 18:785999-786021 GAGATAACACAGCAAGAAGAAGG + Intronic
1153160641 18:2200956-2200978 GAGTTAATACAGAAGGGAGAAGG + Intergenic
1153897946 18:9585479-9585501 CAGTTAATACAGAAAGAAATGGG + Intronic
1154262752 18:12851749-12851771 GAGTTACTAGAGGGGGAAGAAGG - Intronic
1155406400 18:25492621-25492643 GAGATAATACAGAAAGCTGAGGG + Intergenic
1156734611 18:40239284-40239306 AAGTTTATGCAGAGAGAACATGG - Intergenic
1156815834 18:41310087-41310109 AAGTTAATACATAGAGATGGGGG + Intergenic
1157997398 18:52575208-52575230 GAATGGATACAGAGAGAAGATGG - Intronic
1158798591 18:60878565-60878587 GTGTATATACATAGAGAAGATGG + Intergenic
1163420109 19:17209616-17209638 GAGGAAATACAAAGTGAAGATGG + Exonic
1163967344 19:20759202-20759224 GAGTTAAGAGAGAGAGAATGGGG - Intronic
1165133861 19:33652138-33652160 GAGTTATTACACAAAGAAAAAGG - Intronic
1165604501 19:37089568-37089590 GACTGAATACAGAGAGATCAGGG + Intronic
1167225074 19:48232893-48232915 GGCATAATACAAAGAGAAGAAGG - Intronic
1167650784 19:50727522-50727544 GAGAGAGTACAGAGAGATGAAGG - Intergenic
1167862763 19:52298303-52298325 GATTTAACAGAGAGAGCAGAGGG + Intronic
926531610 2:14054009-14054031 GTGTAAATGCAGAGAAAAGAAGG - Intergenic
926641498 2:15242964-15242986 GAGATAATATAGTGAGAAGGGGG + Intronic
928174417 2:29024277-29024299 GAGTTCATCCAGAGAGCAGCCGG + Exonic
928527380 2:32155575-32155597 GAGTTAATAAAGCAAGCAGAAGG - Exonic
930239340 2:48920015-48920037 GAATTCATACAAAGATAAGATGG - Intergenic
930542453 2:52723905-52723927 GTGTCAAAACAGAGAGAAGGAGG + Intergenic
932653720 2:73588287-73588309 GAGATCATAGAGAGAGAAGAGGG - Intronic
933264462 2:80167536-80167558 GAGTAAATACAGTGAAAATATGG + Intronic
933862056 2:86479597-86479619 GAGTTTATACATACATAAGAAGG - Intronic
934147216 2:89107093-89107115 GAGTTAATAGAGACAGGATATGG + Intergenic
934222055 2:90093501-90093523 GAGTTAATAGAGACAGGATATGG - Intergenic
934495720 2:94795653-94795675 GTGTTAACACAGAAAGAAAATGG - Intergenic
936590552 2:113799777-113799799 GAGAAAATACAGAGAACAGAAGG - Intergenic
936656934 2:114499353-114499375 GAGTTCATCCAGGGAGAGGAAGG - Intronic
938211976 2:129475026-129475048 GAGGTAAGGCAGAGATAAGAAGG + Intergenic
939972227 2:148675536-148675558 CATTTTATACAGATAGAAGAGGG - Intronic
940059996 2:149554568-149554590 GAGTTAATACGGATACAAGGTGG + Intergenic
940486420 2:154301921-154301943 GACTTCATACAGAAACAAGATGG + Intronic
941827443 2:169916407-169916429 GAGTCAAAGCAGAGAAAAGAGGG - Intronic
941953316 2:171178469-171178491 GAGTCAATGAAGAGGGAAGATGG - Intronic
942341479 2:174952917-174952939 GAGTTATCAGAGAAAGAAGAAGG + Intronic
942589610 2:177528089-177528111 GAGTGAATATAGAGAAATGAAGG - Intronic
943040537 2:182799460-182799482 GAGTGAAACAAGAGAGAAGAAGG + Intergenic
943388162 2:187227512-187227534 AAGATAATATAAAGAGAAGAAGG + Intergenic
943541825 2:189225054-189225076 GAGTTAACACAGAGATATTATGG + Intergenic
943989115 2:194663584-194663606 GAGTTATTACCTTGAGAAGAAGG - Intergenic
944451508 2:199848335-199848357 GTGTCTATACAGAGAAAAGAGGG + Intronic
944517623 2:200527994-200528016 GAGTTGATACAAAGGGAAGAAGG + Intronic
944824637 2:203469195-203469217 GAGTAAATAGAGAACGAAGAGGG + Intronic
944907078 2:204272650-204272672 TAGTCAATTAAGAGAGAAGAAGG + Intergenic
945607754 2:211957320-211957342 GAGAAAACACAGAGAGAAGTTGG + Intronic
946013154 2:216582818-216582840 GAGATTACACAGACAGAAGAGGG - Intergenic
946214084 2:218170128-218170150 AAGAAAGTACAGAGAGAAGATGG - Intergenic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
947145801 2:227063873-227063895 GAGTTCATACTGAGAAATGAAGG + Intronic
947295574 2:228627011-228627033 GATTTAATCCAGAGAGAAGAGGG - Intergenic
947319231 2:228897813-228897835 GAGACAATACAGAGGGGAGAGGG - Intronic
947622611 2:231600452-231600474 CAGTTAATAGAGACAGAAGGAGG + Intergenic
948400050 2:237677692-237677714 CAGATAATACAGTGATAAGAAGG - Intronic
948484985 2:238274791-238274813 GGGTTGATACAGACAGAACAAGG - Intronic
1169487866 20:6048325-6048347 GAGACAGTACAGAGAGATGAGGG - Intronic
1169547869 20:6669334-6669356 GAGGCTATGCAGAGAGAAGAGGG - Intergenic
1170252919 20:14305461-14305483 CAGTATATATAGAGAGAAGAGGG + Intronic
1171295466 20:24012947-24012969 GTGTCTTTACAGAGAGAAGAGGG - Intergenic
1171354752 20:24535145-24535167 GAGTTAAGACAGGGATGAGATGG + Intronic
1172079644 20:32329565-32329587 GACTGAATGCATAGAGAAGATGG - Intronic
1172183401 20:33017017-33017039 GTGGTAAGACAGAGAGAAGGAGG - Intronic
1172840722 20:37901630-37901652 GCGCTAAGACAGAGGGAAGACGG + Intergenic
1174528372 20:51191548-51191570 GAGGTGACACAGAGATAAGAAGG - Intergenic
1175321448 20:58091018-58091040 GCGTGCACACAGAGAGAAGATGG - Intergenic
1177192222 21:17864621-17864643 GAGTCAATACAGTGGGAAAATGG + Intergenic
1179097644 21:38329819-38329841 GAGAGAGTACAGGGAGAAGAAGG - Intergenic
1179117279 21:38505363-38505385 GAGATAATACAGTGTGGAGAGGG - Intronic
1182823862 22:33245102-33245124 TAGTTAATAATGAGAAAAGATGG - Intronic
1183097999 22:35565845-35565867 GAGTTCACACAGTGAAAAGATGG - Intergenic
949679086 3:6491776-6491798 GACTTATTAAAGAGAGAAGAGGG - Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
952553683 3:34507649-34507671 GATTTTATACATACAGAAGAGGG - Intergenic
952570770 3:34713071-34713093 GACACAATACAGAAAGAAGAAGG - Intergenic
952801388 3:37295670-37295692 TATTTAAAACAGAGAGAGGACGG - Intronic
953597974 3:44336199-44336221 GTGTTAATACAGCTAGAAGGTGG + Intergenic
955019845 3:55109305-55109327 GAGTGAAGATACAGAGAAGAGGG + Intergenic
955858541 3:63300816-63300838 GAAATAATAGAGAGGGAAGAAGG - Intronic
956058808 3:65329122-65329144 GAATTGAGACAGAGAAAAGAAGG - Intergenic
956110385 3:65864631-65864653 AGGTTACTACAGAGAGGAGAAGG + Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956742791 3:72288178-72288200 GAGCTAAGACTCAGAGAAGATGG - Intergenic
957038173 3:75314061-75314083 GAGGTAATACTGAGGGAACATGG + Intergenic
958537249 3:95419018-95419040 GAGTTAACAGAGAGAGGACAGGG - Intergenic
958679494 3:97308541-97308563 GAGTTAATAGAGGGATAAGATGG - Intronic
958963305 3:100531643-100531665 GGGTTAAGGAAGAGAGAAGATGG + Intronic
959052276 3:101535790-101535812 GAGTTAATACAGCCAGAAGGTGG + Intergenic
959433853 3:106288265-106288287 GAGCCAATGCAGAGAGAAGAGGG - Intergenic
959443557 3:106409224-106409246 GAATTAATGCAGAGCGAAGGGGG - Intergenic
960012769 3:112851221-112851243 AAGTAAATACAGAGAGAATCTGG + Intergenic
961676547 3:128570698-128570720 GAGTTCAAACAGAGAAAAGGAGG + Intergenic
961774854 3:129277734-129277756 GATTTATTACAGGGATAAGATGG - Exonic
961943371 3:130659879-130659901 GAGGGAAGACAGAAAGAAGAGGG - Intronic
962093904 3:132274039-132274061 GAGTTCATACCAAGAGCAGAGGG + Intronic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
963494100 3:146038309-146038331 GATTGAATATAGAGAGAAGATGG - Intergenic
963659639 3:148108697-148108719 AACATAAGACAGAGAGAAGAAGG - Intergenic
963659670 3:148109265-148109287 GTGTTAATACAGAGAGCAGCTGG + Intergenic
963829245 3:149989675-149989697 GTATTACTACAGAGAGAAGATGG - Intronic
964978913 3:162654507-162654529 GACTTAATAAAGATAGATGATGG + Intergenic
965470056 3:169079646-169079668 GAAGGAATACAGAGAGAAGTGGG - Intergenic
965517685 3:169639147-169639169 GTATTAATCCAGAGAGAAGTTGG + Intronic
965853734 3:173063414-173063436 GAGGTTTTACAGAGAGAAAAGGG + Intronic
965918168 3:173876906-173876928 GAATTAATACAGAAAGAATGAGG + Intronic
965931571 3:174049934-174049956 GAGTTAAGACTGATAAAAGAGGG + Intronic
966218372 3:177526176-177526198 GAGTAAACACAGGGAGGAGACGG + Intergenic
970396642 4:15674587-15674609 GAGTTGATAAGGAGAAAAGAAGG - Intronic
970697079 4:18690972-18690994 AAGTTAATAAAGAGATATGAGGG - Intergenic
970820446 4:20205631-20205653 CAGTTAAAACAGAGAAAAGAGGG + Intergenic
971279088 4:25226504-25226526 GAGTTAATACAGACGAAACAAGG - Intronic
971301290 4:25444331-25444353 GGGTTAAGGCAGAGTGAAGAAGG + Intergenic
971342847 4:25786626-25786648 GAGCTCATACACAGAGAGGAAGG - Intronic
971498729 4:27295918-27295940 AAGTGAATAAAGAGAAAAGAGGG + Intergenic
971566218 4:28144986-28145008 GACCTAATACAGAAAGCAGAGGG - Intergenic
973163919 4:47053375-47053397 GAGAGAACACAGTGAGAAGAAGG - Intronic
974064878 4:57068470-57068492 GAGCTAATGCACAGATAAGATGG + Intronic
974225391 4:59036280-59036302 CAGTTAACACAGAAAGAAAAGGG - Intergenic
974756916 4:66221474-66221496 GAGGTAATACGGAGCGAAGTTGG + Intergenic
975225487 4:71866411-71866433 GTGACAATACAGTGAGAAGATGG + Intergenic
975465761 4:74707794-74707816 AAGTTATCACAGAGAGAAGAAGG + Intergenic
975927092 4:79470081-79470103 GAGTTAATGCATGGAGAATAAGG + Intergenic
976710727 4:88068123-88068145 GAGTGAATTCAGAGAGATGAGGG - Intronic
979247430 4:118524881-118524903 GTTGTAATACAAAGAGAAGAGGG + Intergenic
979762511 4:124424389-124424411 GAGTTTATAAAGAGTGCAGATGG - Intergenic
980002263 4:127503708-127503730 GTGTTAAAACAGATAAAAGAAGG - Intergenic
980736308 4:136894018-136894040 AAGTTAGTAGAGACAGAAGAAGG + Intergenic
981260960 4:142718215-142718237 AAGTTAAAACAGAGAGAATGGGG - Intronic
981892141 4:149751303-149751325 GAGTTCAGTCAGAGAGCAGAAGG - Intergenic
982102172 4:151978676-151978698 GAGTAAATACAGAGGGGTGAGGG - Intergenic
982429901 4:155310911-155310933 CAGTAACTAGAGAGAGAAGAGGG + Intergenic
982587842 4:157265241-157265263 GAGTTGAAACACAGACAAGATGG + Intronic
983468738 4:168128894-168128916 AAGTATATAGAGAGAGAAGAAGG + Intronic
984027603 4:174562456-174562478 TAGGTACTACAGAGAGAAAAGGG + Intergenic
984179589 4:176465302-176465324 GAGAGAACAAAGAGAGAAGAAGG - Intergenic
984380062 4:178981698-178981720 GATATAATACAGAAATAAGATGG - Intergenic
984857523 4:184207748-184207770 GAATGAATACACAGAGAATAGGG - Intronic
984975376 4:185225859-185225881 GAGTTAATTAAGAGAGACGTGGG - Intronic
985140384 4:186833464-186833486 GACTTAATACAGGAAGAATATGG - Intergenic
986122086 5:4849304-4849326 AAGATAATACAAAGAGAATATGG + Intergenic
986279347 5:6310940-6310962 GTGACAATGCAGAGAGAAGACGG + Intergenic
988104190 5:26722396-26722418 GAGTTAAAACAGATAGAAATAGG - Intergenic
988694325 5:33604788-33604810 GGGTGCATACAGACAGAAGATGG + Intronic
989559995 5:42839367-42839389 ATGTGAATAAAGAGAGAAGATGG + Intronic
990452406 5:55947752-55947774 GATTTACCAAAGAGAGAAGAGGG - Intronic
990786473 5:59426106-59426128 GAGATAACACAGTGAGAAGGTGG + Intronic
991492281 5:67195028-67195050 GAGAGGACACAGAGAGAAGATGG + Intronic
992447331 5:76845805-76845827 GAGCTAATACAAAGAGAAATGGG - Intergenic
992635843 5:78725418-78725440 GAACTTATCCAGAGAGAAGATGG - Intronic
994337059 5:98579445-98579467 GAGTGAATACATAGATTAGAGGG - Intergenic
994805470 5:104441873-104441895 GTGTTAAAACAGAGTCAAGAAGG + Intergenic
994992700 5:107017311-107017333 GAAGAAATACAGGGAGAAGATGG + Intergenic
996139767 5:119892466-119892488 GTGATGATACAGAGAGAAGGTGG + Intergenic
996585110 5:125078977-125078999 GTTTTAATACAAAGAGAATAAGG - Intergenic
997039029 5:130229586-130229608 GAGTTAACAGAGAAAGAAGAAGG + Intergenic
997905316 5:137810847-137810869 GAATGAATAAAGAGAGAATAAGG - Intergenic
998458829 5:142294474-142294496 GAGATAATCCAGAGAGAGAATGG + Intergenic
998878718 5:146626171-146626193 AAGCTAATACAGAGAGAAAGAGG + Intronic
998878725 5:146626229-146626251 CAGCTAATACAGAGAGAAAGAGG + Intronic
1000109459 5:158093990-158094012 GAGTGAATGTAGATAGAAGAAGG - Intergenic
1000183514 5:158836483-158836505 GAAATAATACAGAGAGAGGTAGG + Intronic
1000814392 5:165902824-165902846 GAGATAATAAGTAGAGAAGAAGG + Intergenic
1000847240 5:166297025-166297047 GAGTGTAGACAGAGAAAAGATGG - Intergenic
1000985979 5:167861150-167861172 GAGTAAATAAAGAGAGATGTGGG - Intronic
1001389027 5:171363643-171363665 AAATAAATACAGAGATAAGATGG + Intergenic
1002254706 5:177950624-177950646 GAGGTAAAACACTGAGAAGATGG - Intergenic
1002372912 5:178769031-178769053 GAGGAAACACAGAGAGATGAGGG - Intergenic
1002393636 5:178936466-178936488 GAGTTAAAACAGAAAGAAGGGGG - Intergenic
1002396639 5:178961381-178961403 AAGCTAATACAGAGTGAAAATGG - Intronic
1003752760 6:9079475-9079497 GAGTTGATGCAGAGAAGAGAAGG - Intergenic
1004278852 6:14262109-14262131 AAATTAATACAGAGAGAAACAGG + Intergenic
1004816450 6:19316286-19316308 GTGAGGATACAGAGAGAAGACGG + Intergenic
1006932126 6:37694881-37694903 GAGAAAACACAGAGAGAAAAGGG + Intronic
1006938843 6:37738022-37738044 GAGTGAGTACAGGGAGATGAGGG + Intergenic
1007143426 6:39601320-39601342 GAGTAAATACTGAGACTAGAAGG - Intronic
1008235805 6:49047968-49047990 GAGAAAATACAGAGACAGGAGGG - Intergenic
1009790318 6:68393323-68393345 GAGATAATGCAGAGACAACATGG - Intergenic
1011754876 6:90488199-90488221 GAGTATTTACAGAGAGAAAAAGG - Intergenic
1012950219 6:105510224-105510246 GGGTTTATGCAGAAAGAAGAGGG + Intergenic
1013339297 6:109197874-109197896 GAGCTAAGGCAGAGAGAAGTAGG - Intergenic
1013442160 6:110181218-110181240 GTGTTAATACAGTGAGAAAAAGG + Intronic
1013614874 6:111833509-111833531 GAGTGAAAACAGAGAGAAACGGG + Intronic
1013752759 6:113426229-113426251 GAGTAATTGCAGAGAGAAAATGG - Intergenic
1014687566 6:124522049-124522071 GGGGAAATACAGAGAGTAGAAGG - Intronic
1015210902 6:130697187-130697209 GATTTAATACGGGGAGAAGAGGG - Intergenic
1016501666 6:144727220-144727242 GATTAAAAACTGAGAGAAGACGG - Intronic
1017546110 6:155451964-155451986 AAGATATTACAGAGAGAAGGGGG - Intronic
1017646075 6:156541029-156541051 GAGGGAATTCAGAGGGAAGAGGG + Intergenic
1018917332 6:168143318-168143340 GAGTCAATAAAGAGGTAAGAAGG - Intergenic
1019105925 6:169666817-169666839 GTGTTTCTACAGAGAGCAGAAGG + Intronic
1019342318 7:514312-514334 GGCTTAATAAACAGAGAAGACGG + Intronic
1019838609 7:3416350-3416372 AAGTTAATAAAGAGAAAGGAGGG - Intronic
1020294020 7:6745143-6745165 GATATAATACAGGGAGAGGAAGG + Intergenic
1020814024 7:12882243-12882265 CAGGTATTACAGAAAGAAGAGGG + Intergenic
1021263731 7:18492942-18492964 GAGTTAAATAAAAGAGAAGATGG + Intronic
1021592057 7:22274182-22274204 GAGTGAATGGAAAGAGAAGAAGG - Intronic
1021958230 7:25847762-25847784 CAGATAAGACAGGGAGAAGAAGG - Intergenic
1023070318 7:36425034-36425056 TAGAGAACACAGAGAGAAGAGGG - Intronic
1023327199 7:39073337-39073359 GAGCTAATACAGATAGCTGACGG + Intronic
1023586517 7:41736578-41736600 GAGTGAATACATGGAAAAGAAGG + Intergenic
1025812764 7:64885601-64885623 GGGTTAATACTGAGACTAGAGGG + Intronic
1026266932 7:68803412-68803434 GAGATCATTCAGAGAGAAAAAGG + Intergenic
1029027787 7:97435750-97435772 GAGTTAATACAGTTCGGAGAAGG - Intergenic
1034284432 7:149875126-149875148 GAGTTGTTACAAAGAGAACAGGG - Intronic
1034318571 7:150157951-150157973 GAATTAATATCCAGAGAAGAAGG + Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1038472413 8:27836533-27836555 GAGTAACTGTAGAGAGAAGAGGG + Intronic
1041798632 8:61773487-61773509 GACTTCATACAGAGATAAGTAGG - Intergenic
1042760212 8:72264225-72264247 GAGAAAAAACAGAGAGAAAAAGG - Intergenic
1042818946 8:72909288-72909310 GAGTTAATCAAGGGAGAAGGGGG + Intronic
1043506637 8:80909276-80909298 GAGAAAATACAGACAGCAGAGGG + Intergenic
1044542076 8:93419332-93419354 GAGATACTACAGAAAGAAAATGG + Intergenic
1045065031 8:98436961-98436983 GAGTTAACACGGACAGAAGCGGG - Intronic
1046222820 8:111237706-111237728 GTTTTAACACAGACAGAAGAGGG - Intergenic
1046733860 8:117754956-117754978 GAGATGATATAGAGAAAAGAAGG + Intergenic
1046789115 8:118301930-118301952 AAGATAATACACTGAGAAGATGG + Intronic
1047676532 8:127208806-127208828 CAGTTAAAAAAGAGAGGAGAAGG + Intergenic
1047803952 8:128339283-128339305 GAGTTAGGACAGAGAAAAGCAGG + Intergenic
1048489703 8:134881172-134881194 GTGAGAATACAGGGAGAAGATGG + Intergenic
1048948142 8:139469726-139469748 TAGTTTACACAGGGAGAAGAAGG - Intergenic
1050628196 9:7530060-7530082 GAGTAAAAAGAGAGAGAAAATGG - Intergenic
1050726608 9:8656786-8656808 GAGTTAATAAAGTGAGCAGTAGG - Intronic
1050780871 9:9333371-9333393 GAGTAAAGACAGAGAGAGTATGG + Intronic
1051135592 9:13916733-13916755 GAGTTAAAACATATAGCAGAAGG + Intergenic
1052135300 9:24901905-24901927 GTAATAATACAGAGAAAAGAAGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1056476896 9:86961482-86961504 GAGCTACTACATAGAGAAAAAGG + Intergenic
1056634230 9:88318361-88318383 GAGATAATAGAGAAAGGAGAAGG + Intergenic
1056770353 9:89473999-89474021 GAAGTAGGACAGAGAGAAGACGG + Intronic
1057737147 9:97673644-97673666 AAGTTCATACAGACAAAAGATGG + Exonic
1059905243 9:118976485-118976507 TTGTTACTACAGACAGAAGATGG + Intergenic
1060627492 9:125126966-125126988 GAGATTATACTGAGGGAAGAAGG + Intronic
1060784660 9:126441154-126441176 GAGTAAATACAGAGGAAAAAGGG - Intronic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186921804 X:14290534-14290556 GAGTCATTACATAGAGAAGAAGG + Intergenic
1187195536 X:17080204-17080226 GAGAAAAGGCAGAGAGAAGAAGG - Intronic
1187577209 X:20569987-20570009 GATTTCATAAAGTGAGAAGAGGG - Intergenic
1188267012 X:28089398-28089420 AAGATGATGCAGAGAGAAGATGG - Intergenic
1188487246 X:30695899-30695921 GACTTAGTACAGAAAAAAGAAGG + Intronic
1189521864 X:41777606-41777628 TAGTTATTTCTGAGAGAAGAAGG + Intronic
1190397150 X:49996839-49996861 GAGTTCTGACAGAGAGAAGAGGG - Intronic
1192501590 X:71657424-71657446 AATTAAATACAAAGAGAAGATGG + Intergenic
1192508657 X:71708298-71708320 AATTAAATACAAAGAGAAGATGG + Intergenic
1192511988 X:71726404-71726426 AATTAAATACAAAGAGAAGATGG - Intergenic
1192514709 X:71755101-71755123 AATTAAATACAAAGAGAAGATGG + Intergenic
1192518040 X:71773255-71773277 AATTAAATACAAAGAGAAGATGG - Intergenic
1193503961 X:82316891-82316913 GAGGTAATAGAGAGAGAAAGGGG + Intergenic
1193806244 X:85998228-85998250 GAGTAAATACACAGAGGTGATGG + Intronic
1195785084 X:108510629-108510651 GAATTAGAACAGAGAGAAAAGGG + Intronic
1196058940 X:111386698-111386720 CAGTTCATCCAGAGAAAAGAGGG - Intronic
1196210007 X:112985829-112985851 GAGTTAATAAAGAGATATCATGG - Intergenic
1197084743 X:122458487-122458509 CAGTTAATACATTGTGAAGAAGG + Intergenic
1197161912 X:123333307-123333329 GAGGTAATTCATATAGAAGAAGG + Intronic
1199732815 X:150653343-150653365 GATTTCATACAGACAGAAGAGGG - Intronic
1200087448 X:153614670-153614692 CAGCTAAGACAGAGAGAAGGAGG - Intergenic
1200897053 Y:8386860-8386882 AAGTTAATACAGAGCAAAGTTGG - Intergenic
1201669373 Y:16500174-16500196 TAGTTAAAACAGTGACAAGATGG - Intergenic