ID: 1078334013

View in Genome Browser
Species Human (GRCh38)
Location 11:10450200-10450222
Sequence CAGAGCGAGGAGGGTTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 490}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078334013 Original CRISPR CAGAGCGAGGAGGGTTGGAG AGG Intronic
900387376 1:2416759-2416781 CAGAGTGCAGAGGGTTGGTGTGG + Intergenic
900414419 1:2528512-2528534 CAGGGGGAGGTGGGCTGGAGGGG - Intergenic
900479940 1:2893184-2893206 CAGAGTGGGGTGGGGTGGAGTGG - Intergenic
900597616 1:3489656-3489678 CAGGGGGAGGAGGGCTGGTGTGG - Intergenic
900993541 1:6108618-6108640 CAGAGGGATGAGGGATGGAGTGG + Intronic
901032383 1:6314845-6314867 ATGAGGGAGGAGGGTTGGCGGGG - Intronic
901126767 1:6934755-6934777 CAGAGGGCGTATGGTTGGAGAGG + Intronic
901775548 1:11558422-11558444 GAGAGGGAGGCGGGTGGGAGAGG - Intergenic
902254125 1:15176543-15176565 CAGAGAGTGGAGGGCTGCAGAGG + Intronic
902823390 1:18956734-18956756 CAGAGGGAGGAGGGGTGGGCGGG - Intergenic
902998062 1:20243064-20243086 GGTAGCGAGGAGGGTGGGAGCGG - Intergenic
903221774 1:21873356-21873378 CAGAGTGAGTAGGATTGGGGAGG - Exonic
903243923 1:22002036-22002058 GAGTGAGAGGAGAGTTGGAGTGG - Intronic
903716267 1:25369481-25369503 CAAAGGGAGGAGAGTGGGAGGGG + Intronic
903747596 1:25598644-25598666 CAGTGTTGGGAGGGTTGGAGAGG - Intergenic
904036441 1:27561507-27561529 CACAGCAAGGAGGGGTGCAGGGG + Intronic
906277944 1:44531950-44531972 CAGAAAGAGGAGGCTTAGAGAGG - Intronic
907193790 1:52669918-52669940 CAGAGAGAGGAATGTTGGTGGGG - Intergenic
907486881 1:54784186-54784208 CAGAGGGAGGTGGGGTAGAGAGG + Intronic
907498356 1:54860439-54860461 CAGTGGCAGGAGGGTTGTAGGGG - Intronic
907509059 1:54944976-54944998 ATGAACGAGGAGGGGTGGAGTGG + Intergenic
907787978 1:57632581-57632603 CAGACAGAGGAAGGTTGGGGTGG + Intronic
909242397 1:73230847-73230869 AAGAGCGAGGAGGGATGAATTGG + Intergenic
911368657 1:96970986-96971008 CAGAGAGAGGAGAATGGGAGAGG - Intergenic
911558319 1:99373296-99373318 GAGAGAGAGCAGGGTTGGGGGGG + Intergenic
912382362 1:109254401-109254423 CTGGGGGAGGAGAGTTGGAGGGG + Intronic
913645586 1:120851069-120851091 CAGGGCTAGGAGGGCTGGGGGGG - Intergenic
914098038 1:144560911-144560933 CAGGGCTAGGAGGGCTGGGGGGG - Intergenic
914267718 1:146052329-146052351 CAGGGCTAGGAGGGCTGGGGGGG - Intergenic
914440367 1:147700306-147700328 CAGGGAGGGGAGGGATGGAGGGG - Intergenic
914980501 1:152410645-152410667 CAGAGCCAGCAGGGTTCCAGAGG - Exonic
915694895 1:157729897-157729919 CAGAAGAAGGAGGGTAGGAGGGG + Intergenic
915936338 1:160092249-160092271 CAGAGTGAGGAGGGTGGAGGGGG + Intronic
916021978 1:160800693-160800715 AAGAGGTAGGAGGGTGGGAGAGG - Intronic
917795180 1:178528209-178528231 CAGAGCCAAGAGGGCAGGAGTGG - Intronic
917817564 1:178725715-178725737 GAGAGCGAGGCGGGTTCAAGGGG - Intronic
917832516 1:178908080-178908102 CAGAGTGGGGAGGGTGGGAGAGG - Intronic
918682647 1:187374275-187374297 TAGAGGGAGGAGGGTTGGCGGGG - Intergenic
918795035 1:188883221-188883243 CAGTGAGAGAAGTGTTGGAGAGG + Intergenic
919739474 1:200973382-200973404 GAGAGGGAGGAGGGCAGGAGAGG + Intronic
920210849 1:204327277-204327299 CAGCGCCAGGTGGGTGGGAGAGG - Intronic
920805743 1:209231905-209231927 CGGAGCGCGGAAGGTTGGGGAGG + Intergenic
921708694 1:218352088-218352110 CAGGGGGAGGCGGGCTGGAGTGG - Intronic
922735927 1:227978237-227978259 CAGAGAAGGGGGGGTTGGAGAGG + Intergenic
922927950 1:229366144-229366166 CAGAACGGGGAGAGTGGGAGGGG - Intergenic
923249348 1:232165773-232165795 CAGAGTGGGGAGGGTGGGAGAGG + Intergenic
923251156 1:232180603-232180625 AAGAGAGAGGTGGGTAGGAGAGG + Intergenic
923519273 1:234723377-234723399 CAGAGCAGGGTGGGGTGGAGGGG + Intergenic
1062894789 10:1094995-1095017 GATAGCGAGGAGGGTTAGACTGG + Intronic
1064151269 10:12867193-12867215 CAGAGGAAGGAGGAATGGAGGGG + Intergenic
1065276994 10:24095511-24095533 CAGTGGGAGGAAGGCTGGAGAGG - Intronic
1065289072 10:24212104-24212126 AAGAGAGAGGAGGGGAGGAGAGG + Intronic
1065742246 10:28807654-28807676 AAGAGCGAGGAGGTTGGGAAAGG + Intergenic
1065945908 10:30605441-30605463 CAGAGAGTGGAGGGCAGGAGAGG - Intergenic
1066133515 10:32418341-32418363 TGGAGCGAGGTGAGTTGGAGAGG + Intergenic
1066469320 10:35682827-35682849 AAGAGTGAGGCGGGTGGGAGTGG - Intergenic
1066734165 10:38455872-38455894 CAGAGAAGGGGGGGTTGGAGAGG + Intergenic
1067727650 10:48782906-48782928 AGGAGCAAGGTGGGTTGGAGGGG + Intronic
1067782437 10:49218644-49218666 CACAGAGAGGAGGGGTGGGGAGG - Intergenic
1068654687 10:59562719-59562741 AAGAGAGAGGAGGGATGGGGTGG + Intergenic
1068805332 10:61188757-61188779 CAGGGGGAGAAGGGATGGAGTGG - Intergenic
1069544927 10:69320958-69320980 CGGAGTGAGGAGGGATGGAAGGG - Intronic
1070053963 10:72916318-72916340 CAGAGAGTGGAAGGTAGGAGGGG - Intronic
1070745579 10:78931637-78931659 GAGAGGGAGGAGGGCTGGCGGGG + Intergenic
1070749660 10:78956430-78956452 CTGAGGGAAGAGGGCTGGAGAGG - Intergenic
1071022627 10:81076572-81076594 CTGAGGGTGGAGGGTGGGAGAGG - Intergenic
1073321668 10:102619665-102619687 CAGGGGGAGGAGGGCTGGTGTGG - Intronic
1073701634 10:105934264-105934286 CAGAGTGTGGAGGGTTTCAGAGG + Intergenic
1074700021 10:116084473-116084495 CAGGGCGAGCAGGGTAGGTGAGG - Intronic
1075268374 10:121025923-121025945 GAGAGAGTTGAGGGTTGGAGTGG - Intergenic
1075398198 10:122142782-122142804 CAGAGCAGGGATGGCTGGAGAGG + Intronic
1075522117 10:123149296-123149318 CAGGGAGAGGAGGTCTGGAGGGG - Intronic
1076105851 10:127823174-127823196 CAGAGCGGGGAGGACTTGAGTGG - Intergenic
1076989936 11:267541-267563 AGGAGCGAGGAGGGGAGGAGGGG + Intergenic
1077341171 11:2027064-2027086 CAGAGCAAGGCGGGTGGGCGGGG - Intergenic
1077474877 11:2781620-2781642 CTGGGGGAGGAGGGCTGGAGCGG - Intronic
1077475539 11:2788566-2788588 CAGAGAGAGGAGTGTTGGGTTGG - Intronic
1077616039 11:3674711-3674733 AAGAGCGAGGAGGCTTTGAATGG + Intronic
1077829649 11:5852524-5852546 TAGAGGGAGGAGGGAAGGAGGGG - Intronic
1078066680 11:8083271-8083293 TGGACCGAGGAGGGTGGGAGGGG + Intronic
1078334013 11:10450200-10450222 CAGAGCGAGGAGGGTTGGAGAGG + Intronic
1078543756 11:12231440-12231462 CAGGAAGAGGAGGGTTGGGGAGG - Intronic
1079102848 11:17552365-17552387 CAGAACCAGGTGGGATGGAGGGG - Intronic
1079222897 11:18579535-18579557 CAGTGCCAGGAAGGTGGGAGGGG - Intronic
1080386422 11:31813565-31813587 CAGCGAGATGGGGGTTGGAGGGG - Intronic
1080800860 11:35609106-35609128 CAGAAAGAGGAGGGTTGGCCTGG - Intergenic
1082760839 11:57125378-57125400 CAGAGAGAGGATTGTTGGAGAGG - Intergenic
1083186737 11:61022024-61022046 CACTGCCAGGAGGGGTGGAGTGG - Intergenic
1083722986 11:64612578-64612600 CAGAGGAAGGAGAGTTGGGGAGG - Intronic
1083997907 11:66281144-66281166 CTGAGTGAGGAGAGTTGTAGTGG - Intronic
1084215539 11:67645237-67645259 CGGGGCCAGGAGGGCTGGAGGGG - Intronic
1084758964 11:71256268-71256290 CAGAGCTGGGAGGCTGGGAGAGG + Intergenic
1084959869 11:72710784-72710806 CAGCGGGAGCAGGCTTGGAGGGG - Intronic
1087137073 11:94731818-94731840 CAGAGTAGGGAGTGTTGGAGAGG - Intronic
1087816929 11:102668845-102668867 AAGAGGTAGGAGGGTGGGAGGGG - Intergenic
1089173503 11:116532517-116532539 CAGAGAGAAGAAGGTTGCAGGGG - Intergenic
1089848414 11:121476806-121476828 CAGAGCGAGGAAGGAAGGAAGGG - Intronic
1090226157 11:125073345-125073367 CAGCGGGAGGCGGGGTGGAGGGG + Intronic
1090470902 11:126980265-126980287 AAGAGCAAGGAGGGATGGAGAGG + Intronic
1202824156 11_KI270721v1_random:82253-82275 CAGAGCAAGGCGGGTGGGCGGGG - Intergenic
1091918982 12:4289472-4289494 GAGAGCGGGGAGGGGTCGAGAGG - Intronic
1091937597 12:4445867-4445889 CAGGGCGATGATGGGTGGAGGGG - Intergenic
1092248449 12:6877202-6877224 CAGGGGCAGGAGGGTGGGAGAGG + Intronic
1092289420 12:7150363-7150385 CAGAGTGGGCAGGGATGGAGGGG + Intronic
1096158527 12:49356859-49356881 CCGAGTGAGGAGGGATGAAGAGG + Intronic
1096189002 12:49602811-49602833 CAGAGCTAGGAAGGTTGGGGAGG - Intronic
1096356872 12:50948852-50948874 CAGAGCGAGGAGGAGGGGGGAGG + Intergenic
1096578381 12:52569071-52569093 CAGAGCATGGAGGGTTGTGGGGG + Intronic
1096675910 12:53225774-53225796 CAGAGGGAGGAGGAGAGGAGAGG + Intronic
1096782650 12:53999960-53999982 CAGAGAGAAGGGGGTGGGAGAGG + Intronic
1096871548 12:54595704-54595726 CAGAGTGAGGTGTGTTGGTGAGG + Intergenic
1097925128 12:65118853-65118875 TAGAGAGAGGAGGGAGGGAGAGG + Intronic
1098721961 12:73911756-73911778 CAGAGCTAGGAGGGGTGGGGTGG - Intergenic
1099732779 12:86526284-86526306 TAGGGGGAGGAGGGTTGGCGGGG + Intronic
1099879601 12:88451843-88451865 CAGAGCAGGGAGAGTGGGAGAGG - Intergenic
1099898593 12:88680258-88680280 CAGAGCAAGGGGGGTTGTGGGGG - Intergenic
1100370159 12:93961781-93961803 CAGAAGGAGAAGGGTTGGTGAGG + Intergenic
1100828084 12:98493383-98493405 CAGAGAGGGAAGGGCTGGAGTGG - Intronic
1100938382 12:99695936-99695958 TAGAGCGCGGAGGGTGGAAGGGG + Intronic
1101481743 12:105104769-105104791 CTGAGAGTGGAGGGTGGGAGTGG - Intergenic
1103217401 12:119212621-119212643 CAGAGAGAGGAGGCTTGGAGTGG - Intronic
1104814322 12:131637231-131637253 CAGTGCCAGGAGGGGTGGGGAGG + Intergenic
1105437691 13:20391509-20391531 GAGAGCGGCGAGGGGTGGAGGGG + Intergenic
1105883747 13:24624993-24625015 GAGAGTGAGGAAGGCTGGAGAGG + Intergenic
1105888164 13:24660245-24660267 CAGAACAAGGATGGTAGGAGGGG + Intergenic
1108229829 13:48325123-48325145 CAGAGGGTGGAGGGTGGGAGAGG - Intronic
1109112782 13:58344384-58344406 CAGAGAAAGGAATGTTGGAGTGG + Intergenic
1111161269 13:84398311-84398333 CAGAGGGTGGAGGTTGGGAGTGG + Intergenic
1113406507 13:110045826-110045848 CAGATAGAGGAGGGAAGGAGAGG + Intergenic
1115947589 14:38679665-38679687 CAGAAGGAGGAGGGTAAGAGGGG - Intergenic
1116953476 14:50899578-50899600 CTGAGAGAGGAGGGGTAGAGGGG - Intronic
1117831249 14:59753263-59753285 CAGAGCCAGTAGGGTAGGAATGG - Intronic
1118433562 14:65747748-65747770 CAGAAAGAGGAGGGTGGGAGGGG + Intergenic
1118485856 14:66213899-66213921 CTGAGTGAGGAGGGATGGATTGG + Intergenic
1118971483 14:70641858-70641880 CGGAGGGAGGAGGGCGGGAGCGG + Exonic
1119099930 14:71870512-71870534 CAGAGCTAAGAGGGTTTTAGTGG + Intergenic
1119713174 14:76837758-76837780 CTGAGGGAGTAGGGTTGGGGTGG - Intronic
1119853030 14:77879541-77879563 CAGAGGGAGGAGGGTGGGGCAGG + Intronic
1119896386 14:78223447-78223469 CACATCTAGGAGGGTGGGAGGGG - Intergenic
1120864394 14:89283606-89283628 AAAAGCGGGGAGGGTGGGAGTGG + Intronic
1121629971 14:95414658-95414680 GAGAGAGAGGAGGGAAGGAGAGG - Intronic
1121651591 14:95562835-95562857 CAGAGCGAGTAGGATTTCAGAGG - Intergenic
1122838543 14:104443280-104443302 CAGAGTGGGGAGGGCCGGAGTGG - Intergenic
1122951394 14:105047089-105047111 CAGAGTGGGGATGGTCGGAGGGG + Intergenic
1123028795 14:105440946-105440968 CAGGGCAAGGAAGGTGGGAGAGG + Intronic
1123434924 15:20247852-20247874 GAGAGGGAGGAGGGGAGGAGAGG + Intergenic
1123434932 15:20247874-20247896 GAGAGGGAGGAGGGGAGGAGAGG + Intergenic
1124138171 15:27053477-27053499 AAAAGCCAGCAGGGTTGGAGAGG + Intronic
1124866115 15:33492990-33493012 CAGAGGGAGGAGGGTGTAAGTGG + Intronic
1125449333 15:39791651-39791673 CGGAGGGTGGAGGGTGGGAGAGG + Intergenic
1126110476 15:45172091-45172113 CAGTGCCAGGAGGGGAGGAGTGG + Intronic
1126730941 15:51681644-51681666 AAGAGCCAGGAGGGTGGGTGTGG - Exonic
1128454577 15:67825434-67825456 CAGTGCAAGGAGGGGTGGGGAGG - Intronic
1128521462 15:68377816-68377838 CAGCTAGAGAAGGGTTGGAGTGG - Intronic
1129367636 15:75066310-75066332 CAGAAGGAGGGGGGTTGGGGGGG - Intronic
1130061365 15:80572483-80572505 AAGAGAGGGGAGGGTGGGAGAGG - Intronic
1131830355 15:96351016-96351038 CAGGGACAGGAGGGTGGGAGGGG + Intergenic
1132606099 16:794366-794388 AGGAGCCAGGAGGGTGGGAGGGG + Intronic
1132659915 16:1056737-1056759 CAGAGGGAGGGGAGCTGGAGAGG + Intergenic
1132679641 16:1134459-1134481 CAGAGCGGGGTGGGGTGGGGTGG - Intergenic
1132833481 16:1941180-1941202 CAGAGGGAGGAAGGTGGGACTGG + Intronic
1132973842 16:2701856-2701878 CGGAGGGAGGCAGGTTGGAGTGG + Intronic
1133324279 16:4934069-4934091 CACAGCCAGGAGGGTGGCAGCGG + Intronic
1133381749 16:5336746-5336768 CAGAAGGAGGGGGGCTGGAGGGG - Intergenic
1133722809 16:8510739-8510761 CAGAGTGGGGAGGGATGGAGGGG - Intergenic
1133883806 16:9807329-9807351 GAGAGGGAGGAAGGGTGGAGGGG + Intronic
1134608150 16:15587237-15587259 CAGAGCTAGGAGGGTGGATGGGG - Exonic
1135573635 16:23568130-23568152 CAGAGAGAGTAGGGGTGGAAGGG - Intronic
1135948585 16:26889835-26889857 CAGAAAGAGGAGGGTGGAAGGGG - Intergenic
1135973018 16:27086014-27086036 CAGAAGGTGGAGGGTGGGAGGGG + Intergenic
1135985521 16:27181022-27181044 CAGAGGGCAGTGGGTTGGAGAGG + Intergenic
1136000352 16:27287794-27287816 TAGAGGGAGGATGGTAGGAGGGG + Intronic
1136012673 16:27374234-27374256 CAGAAGGAGGAGGTTTGGCGAGG - Intergenic
1136412408 16:30085080-30085102 GAGGGCCAGAAGGGTTGGAGGGG - Exonic
1137531248 16:49280377-49280399 TAGAGAGAGGAGGGAGGGAGGGG - Intronic
1138169874 16:54838770-54838792 GGGAGCGGGGAGGGTTTGAGGGG - Intergenic
1138475035 16:57265591-57265613 CAGAGCGAGAAGGCATTGAGTGG - Intronic
1139573169 16:67825852-67825874 CAGGGCCAGGAGGGTAGGACGGG + Intronic
1140819115 16:78646916-78646938 TGAAGCGAGGTGGGTTGGAGGGG + Intronic
1141028297 16:80568321-80568343 TTGAGTGAGGAGGGTGGGAGAGG - Intergenic
1141028348 16:80568491-80568513 TTGAGTGAGGAGGGTGGGAGAGG - Intergenic
1141028384 16:80568593-80568615 CTGAGTGGGGAGGGTGGGAGAGG - Intergenic
1141028421 16:80568695-80568717 TTGAGTGAGGAGGGTGGGAGAGG - Intergenic
1141028755 16:80570604-80570626 TTGAGCGGGGAGGGTGGGAGTGG - Intergenic
1141550513 16:84803701-84803723 CGGAGGGTGGAGGGTGGGAGCGG + Intergenic
1141665712 16:85464123-85464145 CAGAGAGAGGAGGGGTGGGCGGG - Intergenic
1142281036 16:89147545-89147567 CAGAGCGAGGAGGGGGTGGGAGG + Intronic
1142606379 17:1083651-1083673 GAGGGAGAGGAGGGTGGGAGGGG + Intronic
1142624192 17:1181459-1181481 CTGAGCCAGGAGGATTGGGGCGG - Intronic
1143114827 17:4576573-4576595 CTGAGAAAGGGGGGTTGGAGAGG + Intergenic
1143195846 17:5075862-5075884 CAGAGTGAGGAAGGTTGCAATGG + Intergenic
1143253510 17:5539366-5539388 CAGAGGGAAGAGGGTTGGGGGGG - Intronic
1144736570 17:17558978-17559000 CAGAGAGAGCAGGGTTGGGATGG - Intronic
1145014579 17:19387859-19387881 CAGAGTGAGGGGGGCTGGGGAGG - Intergenic
1145388317 17:22435271-22435293 CCGAGCGGGGCGGGGTGGAGGGG - Intergenic
1145855009 17:28146859-28146881 CAGAGCAAAGAGGTTTAGAGAGG - Intronic
1147051987 17:37802170-37802192 CAGAGCAAGGAGAGGGGGAGAGG - Intergenic
1147242419 17:39099232-39099254 CAGAGAGATGAGGGGTGAAGGGG - Intronic
1147266197 17:39236503-39236525 CGGGGAGAGGAGGGTAGGAGGGG - Intergenic
1147387024 17:40088917-40088939 GAGAGAGAGGAGCCTTGGAGTGG - Intronic
1147921228 17:43918183-43918205 CAGGGCGCTGAGGGTGGGAGAGG - Intergenic
1148109787 17:45137876-45137898 CAGAGAGCTGAGGGTGGGAGTGG - Intronic
1148168683 17:45501805-45501827 CAGGGCGCTGAGGGTGGGAGAGG - Intergenic
1148280128 17:46341136-46341158 CAGGGCGCTGAGGGTGGGAGAGG + Intronic
1148302356 17:46559073-46559095 CAGGGCGCTGAGGGTGGGAGAGG + Intronic
1148558383 17:48592133-48592155 CAGAGCGGGGAGGATTGGAGGGG + Exonic
1148860534 17:50602205-50602227 CACAGAGAGGAGGGAAGGAGAGG - Intronic
1150399877 17:64848255-64848277 CAGGGCGCTGAGGGTGGGAGAGG - Intergenic
1150636741 17:66918468-66918490 CAGAGAGAGCAGGATGGGAGGGG - Intergenic
1150641068 17:66949887-66949909 CAGAAAGAGGAGGGGAGGAGGGG - Intergenic
1151150078 17:72077435-72077457 CAGAGAGAGTGGGGTTGGTGTGG - Intergenic
1151518145 17:74610379-74610401 CAGAGTGTTGAGGGCTGGAGAGG - Exonic
1151717826 17:75840449-75840471 CAGAGGGAGGGGGTTGGGAGGGG - Intronic
1151930378 17:77228255-77228277 CAGAGCAAGGAGGGCTCGGGGGG + Intergenic
1152103802 17:78317625-78317647 CAGAGCTGGGAGAGTTGGGGTGG + Intergenic
1152557790 17:81063083-81063105 CTGAGCGAGGAGGACTGCAGGGG + Intronic
1152917874 17:83051446-83051468 CAGAACGAGGAAGGTCGGTGAGG + Intronic
1152922127 17:83071360-83071382 CAGAGTCAGGAGGGCTGGGGGGG + Intergenic
1153476861 18:5506504-5506526 CAGAGCCAGGAGGGGTAGACAGG - Intronic
1153493766 18:5676604-5676626 CAGAGACAGGATGGGTGGAGTGG + Intergenic
1153733782 18:8043653-8043675 GAGAGGGAAGAGGGTTGGGGAGG - Intronic
1154058910 18:11039914-11039936 CGGGGTGGGGAGGGTTGGAGAGG - Intronic
1154266155 18:12881002-12881024 CAGTGGCAGGAGGGATGGAGGGG - Intronic
1154312034 18:13274253-13274275 CAGAGGGAGGAGGCCTGGATGGG + Intronic
1154360190 18:13654361-13654383 CAGAACGGGCGGGGTTGGAGGGG + Intergenic
1154999756 18:21674835-21674857 CAGAGGGAGGAGGGGTATAGAGG - Intronic
1155190150 18:23422491-23422513 CAGAGGCAGGAGGGTTGGTGGGG - Intronic
1155229145 18:23756892-23756914 GGGAGCGGGGAGGCTTGGAGGGG - Intronic
1155853976 18:30808933-30808955 TAGAGGGAGGAGGGGAGGAGGGG - Intergenic
1155890485 18:31262041-31262063 CAGAGCCAGGAGGGCAGGACGGG + Intergenic
1156715678 18:40006952-40006974 GAGAGAGAGGGGTGTTGGAGTGG - Intergenic
1157310193 18:46546939-46546961 CAGAGCGAGGAGGGTAGGGGAGG - Exonic
1157824741 18:50802551-50802573 CAGAGGGAGGAGGGCTGGGGTGG + Intronic
1159511317 18:69401014-69401036 CAGAACGCGGAGGGCTGGCGCGG + Intergenic
1159532261 18:69669674-69669696 AAGAGCCAGGAGGGTCGGCGGGG - Intronic
1159635776 18:70803127-70803149 TGGAGGGTGGAGGGTTGGAGAGG + Intergenic
1160543737 18:79639294-79639316 CAGAGGGAGGAGGGTAGAATGGG - Intergenic
1160872205 19:1282551-1282573 GAGGGGGAGGAGGGTGGGAGGGG + Intergenic
1161045197 19:2130791-2130813 CAGTGGGAGGAAGGCTGGAGAGG + Intronic
1161226155 19:3146909-3146931 CAGAGTGAGGAGGGGGAGAGAGG - Intronic
1161243056 19:3233664-3233686 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161253093 19:3291736-3291758 CAGAGTGAGGAGGGGGAGAGAGG + Intronic
1161257916 19:3320147-3320169 CAGAGTGAGGAGGGAGAGAGAGG + Intergenic
1161297181 19:3526042-3526064 TAGAGCAAGGAGGCTGGGAGGGG - Intronic
1161470820 19:4456116-4456138 CGGAGAGGGGAAGGTTGGAGGGG - Intronic
1161479402 19:4503172-4503194 CAGGGGGAGGAAGGGTGGAGGGG - Exonic
1161642947 19:5435706-5435728 CAGAGTGAGGAGGGGGAGAGAGG - Intergenic
1161800939 19:6416476-6416498 AAGATCGAGGTGGGTTGGGGCGG - Exonic
1163094277 19:15044639-15044661 TAGAGGGAGGAGGGCAGGAGAGG - Intergenic
1163551769 19:17969499-17969521 AAGAGGGTGGAGGGGTGGAGGGG - Intronic
1163679060 19:18670129-18670151 CAGGGCGCGGAGGGGTGGAAAGG - Exonic
1163699055 19:18778039-18778061 CAGGGCGAGGAGGGTCGTGGGGG - Exonic
1164188736 19:22896345-22896367 AAAAGGGAGGAGGGTGGGAGGGG - Intergenic
1164471788 19:28542237-28542259 CAGAAGGGGGAGGGTGGGAGAGG + Intergenic
1167649090 19:50719763-50719785 GAGAGCGAGAAGGGTGGCAGAGG - Intergenic
1167893419 19:52560950-52560972 CAGTGAGAGTAGTGTTGGAGGGG - Intronic
1167912053 19:52711759-52711781 CAGGGAGAGTAGTGTTGGAGGGG + Intronic
1167919722 19:52773020-52773042 CAGTGAGAGTAGTGTTGGAGGGG + Intronic
1167927163 19:52830689-52830711 CAGGGAGAGTAGTGTTGGAGGGG + Intronic
1167931427 19:52868922-52868944 CAGTGAGAGTAGTGTTGGAGGGG + Intronic
1168350272 19:55671554-55671576 CAGGGAGAGCAGGGTTGGGGAGG + Intronic
1168674412 19:58266569-58266591 CAGAATGAGGAAGGCTGGAGAGG + Intronic
924991102 2:314042-314064 CAGAACCAGGAGGGTGGGAGGGG + Intergenic
925042212 2:740597-740619 CCCAGCCAGGAGGGCTGGAGAGG + Intergenic
925042259 2:740786-740808 CCCAGCCAGGAGGGCTGGAGTGG + Intergenic
925332884 2:3072319-3072341 CAGAGGAAGGTGGGTGGGAGAGG + Intergenic
926847301 2:17155943-17155965 CAATGAGAGGAGGGTTGGAGGGG - Intergenic
927049805 2:19316184-19316206 CAGAGGGAGGAGGGTGAGAGGGG - Intergenic
927156559 2:20224474-20224496 CGGGGCGAGGAGGGTGGGAACGG + Intronic
927886794 2:26723773-26723795 CAGGGAGAGGAGGCTGGGAGAGG + Intronic
928019391 2:27690300-27690322 CAGAGGGAGGAGGCTGGGAAGGG - Intronic
929607630 2:43245588-43245610 CAGAGGGTTGAGGGTGGGAGTGG - Intronic
931400144 2:61924374-61924396 CGGAGGGGGGATGGTTGGAGAGG + Intronic
931627561 2:64270701-64270723 CAGGGGGAGGAGGGTAAGAGTGG + Intergenic
932398193 2:71462479-71462501 CATGGCGAGCAGGGTTGGGGTGG + Intronic
933262014 2:80141504-80141526 CAGAGCTCACAGGGTTGGAGGGG - Intronic
934034423 2:88077232-88077254 CAGAGTGAAGAGGGCTGGAAGGG - Intronic
934484797 2:94695646-94695668 CAGAGCGGGGAGGGTGACAGGGG + Intergenic
935263132 2:101371818-101371840 CAGAGGGAGGAGCCTTGGACTGG + Intronic
935280322 2:101511744-101511766 CAGAGGGAGGAGGGATGGAGAGG + Intergenic
935380448 2:102446450-102446472 CTGAGGGAGAAGGGTGGGAGGGG - Intronic
935457621 2:103288535-103288557 CACAGCGAGGATGCTTGGGGAGG + Intergenic
936912131 2:117604030-117604052 CAGAGACAGTAGGGGTGGAGGGG + Intergenic
937043198 2:118836427-118836449 AAGAGGGAAGAGGGCTGGAGAGG + Intergenic
937895619 2:126974827-126974849 AAGCGGGAGGAGGGGTGGAGGGG + Intergenic
937897084 2:126985600-126985622 CAGAGCGGGGAGGGAGGGAAGGG - Intergenic
939972948 2:148682662-148682684 CAGTGAGAGGAGGGGAGGAGAGG - Intronic
940545979 2:155085867-155085889 CAGAAGGAGGAGGGTGGGGGAGG + Intergenic
942172514 2:173301894-173301916 AAGAGTGATGAGGGTAGGAGAGG - Intergenic
942412838 2:175729535-175729557 CAGAGTCAGGAAGCTTGGAGAGG - Intergenic
943356483 2:186862295-186862317 GAGAGAGAGGAGGGAAGGAGAGG + Intergenic
944057113 2:195534320-195534342 CAGAGAGAGGAGAGTAGCAGTGG - Intergenic
944493998 2:200288067-200288089 CAGAGGGTGGAGGGTGGAAGAGG - Intergenic
944507868 2:200432242-200432264 CAGAGGGAGGAGCTTTGGTGGGG + Intronic
944856773 2:203775608-203775630 CAGAGTGAGGAGGGTGAGATTGG + Intergenic
946362599 2:219228457-219228479 CAGAGCATCGAGGGCTGGAGAGG - Exonic
946764783 2:223030436-223030458 AAGAGAGAGGAGAGATGGAGAGG + Intergenic
947280928 2:228453988-228454010 CAGAGGGAGAGGGGTGGGAGGGG - Intergenic
948489394 2:238302825-238302847 CAGTGTGTGGAGGGGTGGAGGGG + Intergenic
948505523 2:238424967-238424989 CAGAGCCAGCAGTGCTGGAGGGG - Intergenic
948606907 2:239141595-239141617 CAGAGATGGGAGAGTTGGAGGGG - Intronic
1168872955 20:1146542-1146564 AAGAGCCTGGTGGGTTGGAGAGG + Intronic
1171152731 20:22842152-22842174 CAGAGCCATCAGGGGTGGAGTGG - Intergenic
1171178982 20:23077580-23077602 GAGAGGGAGGAGGGAGGGAGAGG - Intergenic
1171488227 20:25498775-25498797 AAGAGCGTGGAGAGATGGAGGGG + Intronic
1171885141 20:30646572-30646594 GGGGGCGAGGAGGGTTGGAGGGG - Intergenic
1171885153 20:30646599-30646621 GGGAGCGGGGAGGGTTGGGGAGG - Intergenic
1172624406 20:36338969-36338991 CAGAGGGAGGAGGCTGAGAGGGG + Intronic
1172893357 20:38282787-38282809 GAGAGCTAGGAGGGCAGGAGGGG - Intronic
1173555566 20:43963151-43963173 TAGAGCGAGGTAGGTGGGAGGGG + Intronic
1173831544 20:46092134-46092156 CCGAGGGAGGAGGGTTGGTGGGG - Intergenic
1174102354 20:48137398-48137420 CAGAGGAAGGAGGGATGGGGAGG - Intergenic
1174422310 20:50407397-50407419 CAGAGCAAAGAGGGGTGCAGAGG + Intergenic
1174714722 20:52745658-52745680 TAGAGGAAGGAGGATTGGAGAGG + Intergenic
1175144936 20:56888595-56888617 GAGAGAGAGCAGGATTGGAGAGG + Intergenic
1175160139 20:57002324-57002346 AGGAGGGAGGAGGTTTGGAGTGG - Intergenic
1175226255 20:57445612-57445634 GAAAACGAGCAGGGTTGGAGCGG + Intergenic
1175906576 20:62382818-62382840 CAGCGGGTGGAGGGATGGAGGGG + Intergenic
1175934590 20:62509173-62509195 TGGAGGGTGGAGGGTTGGAGGGG - Intergenic
1176047822 20:63101758-63101780 CAGAGAGAGGAGGGAGAGAGAGG - Intergenic
1176115206 20:63429169-63429191 CAGAGTGAGGTGGGTGGGAGTGG - Intronic
1176128727 20:63487345-63487367 CAGAGCAGGGAGGGGTGGAAAGG + Intergenic
1177082791 21:16661806-16661828 TAGAACGAGGAGAGTGGGAGGGG + Intergenic
1177727507 21:24988999-24989021 CAAAGTGGTGAGGGTTGGAGTGG + Intergenic
1177727513 21:24989014-24989036 TGGAGTGGGGAGGGTTGGAGTGG + Intergenic
1177727550 21:24989149-24989171 TGGAGTGGGGAGGGTTGGAGTGG + Intergenic
1177954668 21:27582860-27582882 CAGAGCTAGAAGTGTTGGAGTGG + Intergenic
1178553962 21:33569736-33569758 CTGAGGGAGGATGGCTGGAGTGG + Intronic
1180023318 21:45143168-45143190 CAGTGCCAGGAGGTTAGGAGAGG - Intronic
1180592380 22:16952003-16952025 AAGAGCGAGGAGAGAGGGAGGGG + Intergenic
1180742370 22:18062944-18062966 CAGAAAAAGCAGGGTTGGAGGGG - Intergenic
1181419623 22:22788857-22788879 CAGAGGGAGAAGGGGTGGCGGGG - Intronic
1182168634 22:28203699-28203721 CAGAGGCAGGTGGGTGGGAGTGG - Intronic
1183094384 22:35543336-35543358 CAGAGAGAGGAGGCTCAGAGAGG - Intronic
1183464318 22:37972040-37972062 GAGAGAGAGGAGAGTGGGAGGGG + Intronic
1183733713 22:39632005-39632027 CAGAGTGAGGCGGGTCGGGGAGG + Intronic
1184379581 22:44136668-44136690 CAGAGGGAGGAGAGCTGGGGTGG - Intronic
1184383442 22:44160772-44160794 CAGAGCAATGAGGCTTGGAAGGG + Intronic
1184515135 22:44957087-44957109 CAGAGGGAGGAGGGAGGGGGCGG - Intronic
949393809 3:3593098-3593120 CGGAGGGTGGAGGGTAGGAGGGG + Intergenic
949720367 3:6982293-6982315 AAGAGGGAGAAGGGTAGGAGGGG + Intronic
950289077 3:11769038-11769060 CAGAGGGTGGAGGGGAGGAGTGG + Intergenic
950564000 3:13753916-13753938 CAGATACAGGAGGTTTGGAGTGG + Intergenic
951534101 3:23725999-23726021 GAGAGAGAGGAGGGAGGGAGGGG + Intergenic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
953682440 3:45049995-45050017 CAGGGCAATGAGAGTTGGAGTGG - Intergenic
953687926 3:45092842-45092864 CAGAGGGAGGAGCGTTGGGAGGG - Intronic
954258189 3:49420574-49420596 CAGAGTGGGGAGGGGTGCAGAGG - Intronic
954832563 3:53434977-53434999 CAGAACGAGAAGGTTTGGGGTGG + Intergenic
956776368 3:72568621-72568643 CAGAGGGAGGAAGGTTTGGGGGG - Intergenic
957224362 3:77424775-77424797 CACAAAGAGAAGGGTTGGAGGGG + Intronic
957447390 3:80331660-80331682 CAGAGGGTGGAGGGTGGAAGAGG - Intergenic
959209900 3:103364709-103364731 CAGAGGGTAGAGGGTGGGAGGGG + Intergenic
960036134 3:113104868-113104890 CAGAGCGGGGAGGGAGGAAGTGG - Intergenic
960176121 3:114519490-114519512 CAGGGCAAGGAGGGTGGCAGAGG - Intronic
960946580 3:122970977-122970999 AAGAGCCAGAAGGCTTGGAGAGG + Intronic
962971680 3:140407319-140407341 CAGAGCCTGGAAAGTTGGAGGGG - Intronic
963045745 3:141101414-141101436 CAGAGCGAGGAGGTGGGCAGGGG - Intronic
964459834 3:156912286-156912308 CAGAAGGAGGAGGCTGGGAGAGG - Intronic
964993142 3:162840552-162840574 CAGAGGGTGGAGGGTAGGAAAGG - Intergenic
967878296 3:194281561-194281583 CATAGAGAGGCAGGTTGGAGGGG - Intergenic
968066082 3:195760512-195760534 CAGCGCTAGGATGGATGGAGGGG + Intronic
968952726 4:3702991-3703013 GAGAGGGAGGAGGGGTGGACAGG + Intergenic
968985551 4:3872572-3872594 CAGAGGGAGGATGGGTGGATGGG + Intergenic
969363929 4:6683017-6683039 CAGAGGGTGGAGGACTGGAGGGG - Intergenic
969563990 4:7966896-7966918 CAGAGCAAGGTGTGTGGGAGGGG + Exonic
969701635 4:8770897-8770919 TAGAGCGGGGCGGGGTGGAGGGG + Intergenic
972621346 4:40750426-40750448 AAAAGCGAGGAGGGGTGCAGCGG - Intronic
972848032 4:43013479-43013501 TAGAGTGGGGAGGGATGGAGGGG + Intronic
973368793 4:49228840-49228862 GGGGGCGAGGAGGGTTGGAGGGG - Intergenic
973392250 4:49566574-49566596 GGGGGCGAGGAGGGTTGGAGGGG + Intergenic
973658899 4:53081849-53081871 TAGAGTGAGGAGGGTTGGAGTGG - Intronic
974372573 4:61037079-61037101 CTCAGCGGGGAGGGTGGGAGGGG - Intergenic
976208100 4:82640871-82640893 GATAGGGAGGAGGGCTGGAGAGG + Intronic
977103299 4:92846314-92846336 CAGAGGGAGGAGAGATGAAGGGG - Intronic
978940902 4:114434963-114434985 CAGAGTGAGGAAGGTTGTGGTGG + Intergenic
979260518 4:118638859-118638881 CAGAGAAGGGGGGGTTGGAGAGG + Intergenic
979453069 4:120895505-120895527 AAGAGGGAGGAAGGTTGAAGAGG - Intronic
979468585 4:121070563-121070585 CAGCAGGAGGAGGGGTGGAGGGG + Intronic
980154989 4:129093472-129093494 CGGAGCGGCGGGGGTTGGAGAGG + Exonic
980848141 4:138348783-138348805 CAGAAGGAGGAAGGTGGGAGGGG + Intergenic
982516380 4:156355568-156355590 CAGAGAGGGGAGGGTGGAAGTGG - Intergenic
983268450 4:165532801-165532823 CACACGGAGGAGGGTGGGAGGGG - Intergenic
985733826 5:1565984-1566006 CAGAGCGAGGACAGAGGGAGGGG + Intergenic
985885561 5:2675004-2675026 CAGAGCAGGGAGGGTAGGAGTGG + Intergenic
986299356 5:6466087-6466109 CAGTGCGGGGAGGCATGGAGAGG + Intronic
986321259 5:6633917-6633939 CAGTGAGGGGAGGGTCGGAGAGG - Intronic
987389719 5:17364444-17364466 CAGGGGGAAGTGGGTTGGAGAGG - Intergenic
987762592 5:22184997-22185019 CAGAGAGGGTAGGGTGGGAGAGG - Intronic
990830571 5:59952362-59952384 AAGAGGGAGCAGGGTTGGATGGG - Intronic
991897383 5:71418382-71418404 CAGAGAGGGTAGGGTGGGAGAGG - Intergenic
992093330 5:73338853-73338875 GAGAGGGAGGAGGGTGGGAGAGG + Intergenic
992171887 5:74110167-74110189 AAGAGGGAGGAGAGTTGGACTGG - Intergenic
992181818 5:74205013-74205035 CAGAGAGAGCAGGGTTGGGGTGG - Intergenic
992385410 5:76279834-76279856 CATGACGATGAGGGTTGGAGAGG + Intronic
992403610 5:76434338-76434360 CAGAAAGAGGAGGGTGGGAGGGG - Intronic
992447954 5:76850735-76850757 GAGAGGGAAGAGGGATGGAGGGG + Intronic
992565781 5:77994163-77994185 CTGAGAGAGGAGGGTTTCAGGGG - Intergenic
994467414 5:100155609-100155631 TTGAGGGAGGAGGGTGGGAGAGG - Intergenic
996714857 5:126579027-126579049 CAGAGATGGGAGGGCTGGAGAGG - Intronic
997292182 5:132745596-132745618 CAGAGCGGGGAGGGAAGGAGGGG - Intergenic
999076859 5:148804518-148804540 CAGGGGGAGGAGGGGTCGAGGGG + Intergenic
999317611 5:150594345-150594367 CAGAGCCAGGAGGCTGGAAGAGG + Intergenic
999434919 5:151556031-151556053 CTGAGCCAGGAGGGATGGACTGG + Intronic
999825236 5:155267340-155267362 CAGAGGGTGGAGGGTGGGATGGG - Intergenic
1001831394 5:174792263-174792285 CAGAGTGTGGAGGGTAGGAGTGG - Intergenic
1002072974 5:176691450-176691472 CAAAGAGAAGAGGGTTGGACAGG - Intergenic
1002177921 5:177412617-177412639 CAGAAAGAGGAGGGCAGGAGAGG + Intronic
1002318305 5:178359909-178359931 GAGAACGAGGAGGGCTGCAGAGG + Intronic
1002567210 5:180118871-180118893 AAGAGGGAGGAGGGTTGGAGAGG + Intronic
1002795709 6:469697-469719 CAGAGAGAGGAGGGGGAGAGAGG - Intergenic
1003595528 6:7470931-7470953 TAGAGAGATGAGGGTGGGAGTGG - Intergenic
1003596262 6:7476817-7476839 TAGAGAGATGAGGGTGGGAGTGG + Intergenic
1003709847 6:8577037-8577059 TAGGGCGAGGAGGGTTGGGGAGG - Intergenic
1004318408 6:14612437-14612459 CAGCCTGAGGAGGGTGGGAGGGG + Intergenic
1004583757 6:16979526-16979548 CAGACAGAGGAGGGCTGGTGAGG - Intergenic
1005358191 6:25005156-25005178 CAGAGCTAACAGGATTGGAGTGG + Intronic
1006203740 6:32320829-32320851 CAGAGGGTGGAGGGTGGGAGCGG - Intronic
1006236227 6:32635544-32635566 CAGAAAGTGGAGGGTTGGGGTGG + Intronic
1006401067 6:33817710-33817732 CAGTGGGAGAAGGGTTGGAGAGG - Intergenic
1006427990 6:33978078-33978100 CAGGGAGAGGAAGGTGGGAGTGG - Intergenic
1006942047 6:37758883-37758905 CAGAGCCAGGAGGGAGAGAGAGG + Intergenic
1007186965 6:39980069-39980091 CTGAGGGAGGAGGATGGGAGGGG - Intergenic
1007654423 6:43443752-43443774 CAGAGCAGGGTGGGTTAGAGAGG + Intronic
1007693381 6:43716979-43717001 CATATGGAGGAGGGTTGGGGTGG + Intergenic
1008803683 6:55401944-55401966 CAGAGAGGGGAGGGGAGGAGAGG - Exonic
1010656582 6:78518525-78518547 CAGAGGGAGGTGGGGTGGAAGGG - Intergenic
1011215943 6:85005667-85005689 CAGAGCTAGCCAGGTTGGAGAGG + Intergenic
1011936328 6:92782903-92782925 GAGAGAGAGGAGGGTGAGAGAGG + Intergenic
1012508835 6:99979042-99979064 CGGAGGGAGGTGGGTTGGATGGG + Intronic
1012618385 6:101306516-101306538 TAGAGCAAGGATGGATGGAGGGG + Intergenic
1015841768 6:137484753-137484775 CAGTGAGGGGAGGGTGGGAGTGG + Intergenic
1016990700 6:149925941-149925963 CAGGGCGAGGAGGATGGGGGGGG - Intergenic
1017996245 6:159534045-159534067 CAGAGTGAGGATGGTAGGAGTGG + Intergenic
1018162635 6:161061532-161061554 CACAGTGAGGATGGTTGCAGTGG - Intronic
1018681484 6:166269463-166269485 CAAAGCCAGGAAGGTGGGAGAGG + Intergenic
1019289276 7:242447-242469 CAGAAGGAGGAGGGTGGGAAGGG + Intronic
1020098468 7:5381245-5381267 CAGAGTGAGGAGGGTAGAGGAGG - Intronic
1020643100 7:10780044-10780066 TAGAGCGAGGAGGGTCGAGGAGG - Intergenic
1022532273 7:31074471-31074493 GAGGGCGAGGAGGGCTGCAGAGG - Intronic
1024268279 7:47622897-47622919 GAGAGAGAGGAAGGTTGGGGGGG - Intergenic
1025128191 7:56362360-56362382 CAGAGAAGGAAGGGTTGGAGAGG - Intergenic
1025850262 7:65238860-65238882 GTGAGCGAGGTGGATTGGAGTGG - Intergenic
1026082677 7:67235988-67236010 CAGAGCCAGCAGGCTTGGTGGGG + Intronic
1026508245 7:71005157-71005179 CAGAGGAAGGGGGGTTGGTGAGG + Intergenic
1026545395 7:71317639-71317661 CACAACGTGGAGGGCTGGAGTGG + Intronic
1026649224 7:72200316-72200338 GAGAGGAAGGAGGCTTGGAGAGG - Intronic
1026694388 7:72578022-72578044 CAGAGCCAGCAGGCTTGGTGGGG - Intronic
1027707134 7:81549115-81549137 CAGAGCGAGGAAGGAAGGAAAGG - Intergenic
1029298389 7:99559134-99559156 CAGGGCGAGGGTGGTGGGAGGGG + Intronic
1029745212 7:102512603-102512625 GAGAGGGAGGAGAGTAGGAGGGG + Intronic
1029745220 7:102512628-102512650 GAGAGGGAGGAGAGTAGGAGGGG + Intronic
1029763204 7:102611764-102611786 GAGAGGGAGGAGAGTAGGAGGGG + Intronic
1030133121 7:106219945-106219967 CAGAACTAGGAGGGCTAGAGAGG - Intergenic
1030659545 7:112205518-112205540 GAGAGGGAGGAGGGTCAGAGAGG + Intronic
1032928987 7:136643281-136643303 TAGAGCGTACAGGGTTGGAGAGG - Intergenic
1034422075 7:150995663-150995685 GAGAGGGAGGAGGGGTGCAGGGG - Intronic
1034422098 7:150995725-150995747 CAGAGGGAGGAGGGGTGTAGGGG - Intronic
1034422126 7:150995792-150995814 GAGAGGGAGGAGGGGTGCAGGGG - Intronic
1034422141 7:150995825-150995847 CAGAGGGAGGAGGGATGCAGGGG - Intronic
1034422154 7:150995858-150995880 GAGAGGGAGGAGGGGTGTAGGGG - Intronic
1034422219 7:150996022-150996044 CAGAGGGAGGAGGGGTGCAGGGG - Intronic
1034422245 7:150996088-150996110 CAGAGGGAGGAGGGGTGCAGGGG - Intronic
1034422273 7:150996154-150996176 GAGAGGGAGGAGGGGTGCAGAGG - Intronic
1034422320 7:150996285-150996307 GAGAGGGAGGAGGGGTGCAGTGG - Intronic
1035224996 7:157428037-157428059 CAGAGGGAGGAGGGACGAAGGGG + Intergenic
1035705453 8:1671173-1671195 CAGAGCAGAGAGGGGTGGAGTGG - Intronic
1035980581 8:4366073-4366095 CTGAGTGGGGAGGGTAGGAGAGG - Intronic
1038276097 8:26122160-26122182 CAGAGAGAGGAGGGCAGGACAGG + Intergenic
1039569440 8:38575386-38575408 CAGAGCCAGGAGGGCAGGAGAGG - Intergenic
1040080915 8:43284108-43284130 TAGAGGGAGGAGGGCTGGAGTGG + Intergenic
1040719854 8:50306042-50306064 CAGAAGGGGGAGGGTGGGAGGGG - Intronic
1041178381 8:55221643-55221665 GAGAGCGATGGGGGTGGGAGAGG - Intronic
1041300645 8:56407786-56407808 CAGAGGGGGAAGGGGTGGAGGGG + Intergenic
1042397407 8:68307998-68308020 CAGAGTGGGGAGGGTGGGTGAGG + Intronic
1044828725 8:96224245-96224267 CAGAGTGGGGAGGGATGGAAGGG + Intergenic
1045208814 8:100072913-100072935 GAGAGAGAGAAAGGTTGGAGAGG + Intronic
1047256345 8:123216207-123216229 CAAAGCGAGTTGGGCTGGAGTGG + Intergenic
1047287918 8:123504351-123504373 CAGAGAGAGGAGGATTTAAGGGG + Intronic
1047356217 8:124124712-124124734 CAGAGGGAAGAGGTTTGGAATGG - Intergenic
1047359618 8:124156163-124156185 TAGAGGGAGGAGGGTAGGATGGG - Intergenic
1047374870 8:124286431-124286453 GAGAGAGAGGAGGGTAGGGGAGG - Intergenic
1048934497 8:139343791-139343813 CACAGGGAGGAGGGTTGGGGTGG + Intergenic
1049362061 8:142216576-142216598 CAGTGCGGGGAGGGGTGGGGTGG - Intronic
1049444658 8:142624448-142624470 CAGAAAGAGGAGGAGTGGAGAGG + Intergenic
1049889424 9:54831-54853 CAGAAGGAGGAGGGCGGGAGGGG - Intergenic
1050139385 9:2501751-2501773 CAGAGTGAGTAGATTTGGAGGGG + Intergenic
1050463790 9:5899260-5899282 GAAAGAGAGGAGGGTTGGTGTGG + Intronic
1051101955 9:13531994-13532016 AAGAGAAAGGAGGGGTGGAGAGG + Intergenic
1051288508 9:15521432-15521454 CAGGGGGAGGTGGGATGGAGGGG - Intergenic
1053672998 9:40388724-40388746 CAGAGCGGGGAGGGTGACAGAGG - Intergenic
1053922808 9:43015093-43015115 CAGAGCGGGGAGGGTGACAGAGG - Intergenic
1054384107 9:64528790-64528812 CAGAGCGGGGAGGGTGACAGAGG - Intergenic
1054511627 9:65987559-65987581 CAGAGCGGGGAGGGTGACAGAGG + Intergenic
1054890775 9:70249370-70249392 CAGAAAGAGGAGAGTGGGAGAGG + Intergenic
1055589983 9:77802259-77802281 CAGAGTGAGGGGGGTTGCATGGG - Intronic
1057581777 9:96293541-96293563 CAGAGAGAGAAGAGTGGGAGAGG - Intronic
1057792025 9:98130801-98130823 GGGAGCCAGGAGGGTGGGAGGGG + Intronic
1057816669 9:98301035-98301057 CAGAGCGAGGACGGGTGAAGGGG - Intronic
1058270133 9:102962082-102962104 CAGAAGGTGGAGGGTAGGAGGGG - Intergenic
1058737008 9:107902982-107903004 GAGAGCAAGGATGGTTGGATGGG + Intergenic
1059165567 9:112073509-112073531 CAGAGAGAGGAGGATGGGGGTGG - Intronic
1059450810 9:114370510-114370532 CAGAGCGATGAGGTGGGGAGTGG + Intronic
1059890338 9:118795091-118795113 CTGAGAGTGGAGGGTGGGAGAGG - Intergenic
1060982940 9:127803850-127803872 CAGAGTCATGAGGGTTGGGGTGG + Intronic
1061262962 9:129490077-129490099 TACAGCCAGGAGGGGTGGAGGGG - Intergenic
1061445753 9:130636290-130636312 CAGAGCGAGGAGGGACAGAGGGG - Intronic
1061560179 9:131397022-131397044 CACAGCTAGGAGGTCTGGAGGGG - Intronic
1061681333 9:132243845-132243867 CAGAGAGAGGAGGCCAGGAGGGG - Exonic
1061713928 9:132506867-132506889 CAGTGCGAGGAGGATTAGTGTGG + Intronic
1061743287 9:132722718-132722740 CACAGAGAGGGAGGTTGGAGGGG - Intergenic
1185570851 X:1133818-1133840 CAGAGTGGGGAGGGGTGGTGAGG - Intergenic
1185595944 X:1307086-1307108 CGGAGAGAGGTGGGTGGGAGAGG - Intronic
1186410702 X:9342557-9342579 CAGGGAGAGGAGGCTAGGAGGGG - Intergenic
1186549848 X:10492352-10492374 CTGAGCAAGGAGGGTGAGAGAGG - Intronic
1186872567 X:13786898-13786920 CAGAGACAGGAGGTTAGGAGAGG - Intronic
1188340769 X:28998464-28998486 GAGAGGGAGGTGGGGTGGAGAGG + Intronic
1188863734 X:35288497-35288519 CAGAGGGTGGAGTGTGGGAGGGG + Intergenic
1189278103 X:39801922-39801944 CAGAGACAGGAGAGTAGGAGAGG + Intergenic
1189743100 X:44141989-44142011 TAGAGAGAGGAGGGCAGGAGAGG + Intergenic
1189970004 X:46408372-46408394 AAGAGGGAGGAGGGATGGAGTGG + Intergenic
1190059756 X:47203101-47203123 CAAAGGGAGGAGGGTTAGAGAGG - Intronic
1191178403 X:57531997-57532019 AAAAGAAAGGAGGGTTGGAGGGG + Intergenic
1191670578 X:63745027-63745049 CAGAGGGAGGAGGGAGAGAGTGG + Intronic
1194088519 X:89558253-89558275 CAGAAGGGGGAGGGTAGGAGGGG + Intergenic
1194089904 X:89572922-89572944 CAGAAGGGGGAGGGTGGGAGGGG - Intergenic
1194580614 X:95666248-95666270 CCCAGTGAGGAGGGATGGAGTGG - Intergenic
1195311222 X:103633638-103633660 CTGAGCAAGGTGGGTGGGAGAGG - Intergenic
1196777461 X:119352548-119352570 GAAAGGGAGGAGGGTGGGAGAGG + Intergenic
1196796844 X:119508740-119508762 CAGAAAGGGGAGGGTGGGAGTGG - Intergenic
1197048657 X:122031282-122031304 CAGAAGGAGGAGGGTAGGAGTGG - Intergenic
1197618406 X:128719958-128719980 CAGAAGGAGGATGGTAGGAGGGG - Intergenic
1197762878 X:130039960-130039982 CAGGGGGAGGAGGGAAGGAGGGG + Intronic
1198038324 X:132823422-132823444 CAGAAGGAGGAGGGTGGGAGTGG - Intronic
1199680499 X:150221243-150221265 CAGAGAGAGGAGGGCTGCAGAGG - Intergenic
1199866896 X:151859792-151859814 CAGAGGGTGGAGGGTGGGAGAGG + Intergenic
1200068727 X:153517621-153517643 CTGAGCGCGGAGGGAGGGAGGGG - Intergenic
1200236795 X:154471695-154471717 CAAAGGCAGGAGGGTTGGTGGGG + Intronic
1200441195 Y:3214300-3214322 CAGAAGGGGGAGGGTAGGAGGGG + Intergenic
1200442555 Y:3228976-3228998 CAGAAGGGGGAGGGTGGGAGGGG - Intergenic
1201101777 Y:10683549-10683571 CAGAGTGAAGAGGATTTGAGTGG - Intergenic
1201122841 Y:10886335-10886357 CAGAGTGAAGAGGAGTGGAGTGG - Intergenic
1201129592 Y:10942591-10942613 CAGAGTGAAGAGGAGTGGAGTGG - Intergenic
1202381994 Y:24281230-24281252 CAGAGAAGGGGGGGTTGGAGAGG + Intergenic
1202488790 Y:25388895-25388917 CAGAGAAGGGGGGGTTGGAGAGG - Intergenic