ID: 1078345247

View in Genome Browser
Species Human (GRCh38)
Location 11:10541894-10541916
Sequence GCAGCAGTGTCAGCTGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078345247_1078345249 1 Left 1078345247 11:10541894-10541916 CCAGGTACAGCTGACACTGCTGC No data
Right 1078345249 11:10541918-10541940 TCTATGCTTAGCAGTTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078345247 Original CRISPR GCAGCAGTGTCAGCTGTACC TGG (reversed) Intergenic
No off target data available for this crispr