ID: 1078350077

View in Genome Browser
Species Human (GRCh38)
Location 11:10585901-10585923
Sequence GCTTCTATTGAAAGAAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078350077 Original CRISPR GCTTCTATTGAAAGAAAAGC GGG (reversed) Intronic
904227693 1:29037547-29037569 ACTTGTATTGAAAGGAAAGTTGG + Intronic
905354402 1:37371353-37371375 GCTTCCAGTGAATAAAAAGCAGG + Intergenic
905534869 1:38713302-38713324 GGTCCTTTTGAAAGGAAAGCTGG + Intergenic
906977998 1:50596085-50596107 CCTTCTGTTCAAAGAAAAGCTGG + Intronic
907769829 1:57450039-57450061 GCTTCTAGTGAAAAATAACCTGG - Intronic
907876977 1:58499807-58499829 ACTTGTATTGAAAAAAAAACTGG + Intronic
908064745 1:60390521-60390543 GCTTATATTGAAATAGCAGCAGG - Intergenic
908985112 1:70008230-70008252 GCTTCCAGTGAATGTAAAGCAGG - Intronic
911065971 1:93788854-93788876 TCTACTACTGAAAGGAAAGCAGG - Intronic
911416536 1:97581799-97581821 GCTAATCTTGAAAGAAAAGTAGG + Intronic
914348257 1:146818121-146818143 GCATCTAATGAAAGAGAAGATGG + Intergenic
916210913 1:162359214-162359236 GCTTGTATTGAGAGTCAAGCAGG - Intronic
917506394 1:175630926-175630948 GCTGCTCTGGAGAGAAAAGCAGG + Intronic
918644689 1:186889845-186889867 GATTCTATGGAAAGAGGAGCTGG - Intronic
919463626 1:197907705-197907727 GTTTTTATTGAAAGAACAGATGG - Intergenic
921754460 1:218837779-218837801 GCATCTATAGGAAGAAAATCCGG + Intergenic
922962087 1:229656205-229656227 GCTTTTGATGAAAGAAAAGCTGG + Intronic
922989013 1:229889237-229889259 GCCTGTATTGAAAGAGAGGCTGG + Intergenic
923330807 1:232922763-232922785 GATTTTATTGCAAGAAAAGTAGG - Intergenic
923760732 1:236841691-236841713 GCTTCTTGTGAAAGAAAACATGG + Intronic
1062946588 10:1466305-1466327 GCTTCTGATGAATGAAAACCCGG + Intronic
1063186658 10:3658008-3658030 GCTGCTTTTGAAAGAAAACGAGG - Intergenic
1065942464 10:30577272-30577294 CCATCTATTGAAGGAAAGGCTGG + Intergenic
1066056189 10:31682342-31682364 GCATTTATTGAAAAAAAAGTTGG + Intergenic
1067962851 10:50875955-50875977 ACTTGTATTGAAAGAAAATCAGG - Intronic
1068435038 10:56979681-56979703 CTTTCTAGGGAAAGAAAAGCAGG + Intergenic
1069098450 10:64288567-64288589 GCTTGGGTTGAAAGAAAAGAAGG - Intergenic
1069619586 10:69828530-69828552 AGTTTTACTGAAAGAAAAGCAGG - Intronic
1070067858 10:73055661-73055683 ACTTCTATTTTAAGAAAAGGAGG + Intronic
1070090637 10:73281966-73281988 GATTCTAGTGAAAGAGAAGGTGG + Intronic
1070123811 10:73603948-73603970 GCTACTATTAAAAAAAAAGGTGG + Intronic
1070391525 10:75975039-75975061 GTTTTTATTTAAAGAAATGCTGG - Intronic
1071838487 10:89444101-89444123 GGTTTTATGGAAACAAAAGCAGG + Intronic
1073633301 10:105170894-105170916 GCTCCTAGTGAAGAAAAAGCTGG - Intronic
1073707927 10:106007372-106007394 GCTGATATTGAAAGAAGAGTAGG - Intergenic
1078350077 11:10585901-10585923 GCTTCTATTGAAAGAAAAGCGGG - Intronic
1078350083 11:10585936-10585958 GCTTCTATTGAAAGAAAGGTGGG - Intronic
1078350091 11:10585971-10585993 GCTTCTATTGAAAGAAAGGTGGG - Intronic
1078350100 11:10586008-10586030 ACTTCTGTTGAAAGAAAGGCAGG - Intronic
1078899119 11:15625008-15625030 GTTTTATTTGAAAGAAAAGCAGG - Intergenic
1079901719 11:26195064-26195086 ACTTCTATTGGTAGAAAAACAGG - Intergenic
1080726975 11:34907958-34907980 GCTTAAGTTGAAAGAAAAGATGG - Intronic
1081378612 11:42388424-42388446 GCTTCTAGTGAATATAAAGCAGG + Intergenic
1081394878 11:42574964-42574986 GCTTCTATGGAAAAAAAAAATGG - Intergenic
1083314407 11:61805381-61805403 GCCTCTCTTGAAAGAAAACTGGG + Intronic
1086042775 11:82498932-82498954 GCTTCTATAGAAATAAAAAGTGG + Intergenic
1086609511 11:88738425-88738447 CCATCTATTGTAGGAAAAGCTGG + Intronic
1086808985 11:91281253-91281275 GATTCTATTGAGAGTAGAGCAGG + Intergenic
1087377261 11:97359888-97359910 GCTTCCTTTGAAAGAAATACAGG + Intergenic
1088238332 11:107748919-107748941 GCTTTTTGTGTAAGAAAAGCAGG + Intergenic
1090492255 11:127175177-127175199 GCTTTTAATGAAGGACAAGCAGG + Intergenic
1092743753 12:11654256-11654278 GATTCTATTGTCAGAAAAACTGG - Intronic
1093740568 12:22680659-22680681 GCTTTGATAAAAAGAAAAGCAGG + Intronic
1094044977 12:26157565-26157587 GCTTCTTTTAAAAAAAAATCTGG + Intronic
1095785676 12:46106524-46106546 GCTTCCCTTGAGATAAAAGCTGG + Intergenic
1095973839 12:47925610-47925632 ACATCTATTGAAAGAAAGGAAGG - Intronic
1099921590 12:88964131-88964153 TTTTATATTTAAAGAAAAGCTGG - Intergenic
1101169453 12:102074857-102074879 GCTTAAATTGCAAGAAAAGGTGG - Intronic
1102536015 12:113582081-113582103 GCTTCTTGGGAAAGGAAAGCAGG - Intergenic
1103647895 12:122409420-122409442 GCTTCTCTTGAAATATAGGCTGG - Intronic
1103707367 12:122884371-122884393 GATTCTCTTGAAAGAAAACTTGG - Intronic
1104073613 12:125370201-125370223 GCATCTATTTAAGGAAAGGCAGG + Intronic
1105729890 13:23202009-23202031 GCTGCTACTGAAAGATGAGCAGG + Intronic
1107500656 13:40971417-40971439 GTTTCTATTAAAAAAATAGCTGG - Intronic
1108242510 13:48480685-48480707 GCTTTTAATTAAATAAAAGCTGG + Exonic
1109786619 13:67184287-67184309 GGTTATAATGAAAGAAAAGGAGG + Intronic
1110443040 13:75546525-75546547 GCTTCTATTCAAAGACAAGCAGG - Intronic
1111691484 13:91568552-91568574 GCTTTTATTGAAAAAAAAAAAGG + Intronic
1112332786 13:98489533-98489555 ACTTCTAATGACAGAAAAGTGGG + Intronic
1112924097 13:104651782-104651804 GCTTCTCTTTTAACAAAAGCAGG + Intergenic
1118352689 14:64984783-64984805 TGTGCTATTGAAAGAATAGCTGG - Intronic
1119345694 14:73921990-73922012 GCTTCTGTTGAAAGAAAATGAGG + Intronic
1121204055 14:92146741-92146763 GATTTTATTGAAAGAGAAGAAGG - Intronic
1121232800 14:92370567-92370589 GCTTTTATTAAAACAAAAGAAGG + Intronic
1124931561 15:34124838-34124860 TCTTCTCTTGATAGAAAAACAGG + Intergenic
1125400396 15:39296091-39296113 TCTCCTTTTGAAAGAAAAGAAGG - Intergenic
1129634041 15:77296090-77296112 GTTTTTATTGAAAGAAAATAAGG - Intronic
1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG + Exonic
1133185297 16:4091966-4091988 GCTTCAATTAAAAATAAAGCAGG + Intronic
1133880780 16:9779660-9779682 CCCTCTATGGAAAGAAAAACAGG - Intronic
1137377990 16:47970719-47970741 GTTTCTAAAGAAAAAAAAGCAGG - Intergenic
1139985779 16:70897424-70897446 GCATCTAATGAAAGAGAAGATGG - Intronic
1140590169 16:76342341-76342363 GCATCTGTTGAAGGAAAAACTGG + Intronic
1140792285 16:78403611-78403633 GCTTCTATTAAAATAATACCTGG - Intronic
1141362726 16:83411328-83411350 GCTTCAAAAGAAAGAAAAGTGGG - Intronic
1146525217 17:33561698-33561720 GTGTGTATTGAAAGAAGAGCAGG + Intronic
1147790701 17:43012926-43012948 ACATTTACTGAAAGAAAAGCTGG - Intronic
1150191960 17:63252009-63252031 TCTTATATTTAAATAAAAGCTGG - Intronic
1155460023 18:26068356-26068378 GCTTTTATTGCATAAAAAGCAGG + Intronic
1155509804 18:26565050-26565072 GCTACTCTTTAAAGAAAAGTTGG - Intronic
1157772540 18:50361973-50361995 CCTTCTGTTTAAAGAAAAGGAGG - Intergenic
1158021363 18:52846023-52846045 GCTTCTATTAAACAAAAAACTGG - Intronic
1159405140 18:67992096-67992118 TGTTCTGTTGAAAGAAAAGTTGG + Intergenic
1164270978 19:23671453-23671475 GCTTCAAATGCAAGAAAAGTGGG + Intronic
1164625519 19:29725007-29725029 GCTTTCACTGTAAGAAAAGCAGG - Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
927360787 2:22230241-22230263 GCTTCTACGGAATGAAAAGCGGG + Intergenic
928337498 2:30410414-30410436 GCTTCAAAGGAAAGAAGAGCAGG - Intergenic
929055293 2:37871408-37871430 GCTTGGATTAAAAGAAAAGAAGG - Intergenic
930242775 2:48953476-48953498 GCCTCAATAGAATGAAAAGCAGG - Intergenic
931713532 2:65010251-65010273 GCTGCTTTTAAAAGAAGAGCTGG - Intronic
935534923 2:104283095-104283117 TATTCTATTAAAAGAAAAGGGGG - Intergenic
936986788 2:118319160-118319182 GCTTTAAATGAAAGAAAAGAAGG - Intergenic
938985162 2:136568117-136568139 GTTTCTATTTAATGAGAAGCTGG + Intergenic
941422931 2:165305728-165305750 CCATCTTTAGAAAGAAAAGCTGG + Intronic
941687087 2:168457507-168457529 GGTGCTACTGAAAGAAAACCAGG + Intronic
945727561 2:213491699-213491721 GCTTCTATTAAATGAAAATGTGG + Intronic
945831026 2:214785045-214785067 GCTTCTATGGAAAGAACAAATGG - Intronic
948039229 2:234886252-234886274 GCTGCTATTTAATGAAAAGAGGG - Intergenic
948724025 2:239920788-239920810 CCTGCTATTGAAAGAAAGCCTGG + Intronic
1168881823 20:1212719-1212741 CCTTATATGGAAAGAAAGGCAGG - Intergenic
1169652750 20:7887892-7887914 GCAGCTATTGAAAGAAAAAAGGG - Intronic
1170699747 20:18693346-18693368 TTTTCTATTACAAGAAAAGCTGG - Intronic
1171006663 20:21472760-21472782 GCAGCTTTTGAAGGAAAAGCTGG - Intergenic
1173961335 20:47074635-47074657 GCTTCTTTTGAAAGAAGATCTGG + Intronic
1177198418 21:17927593-17927615 GCTGCTATTAAAATGAAAGCAGG - Intronic
1178557212 21:33602836-33602858 CCTTTTCTTCAAAGAAAAGCAGG + Intronic
1178818498 21:35953449-35953471 ACTTCCATTAAAAAAAAAGCAGG - Intronic
1179205764 21:39276644-39276666 GCTTCAAATAAAAGAAAAGATGG + Intronic
949418100 3:3834820-3834842 GCTTCTAGTGAATATAAAGCAGG - Intronic
949590253 3:5486818-5486840 AATTCTATTGAAACAAAAGGTGG - Intergenic
951147813 3:19250233-19250255 TCTTTTTTTGAAAGAAAGGCTGG - Intronic
951373909 3:21889407-21889429 GCCTCTGTGGAAAGAAAAGTAGG + Intronic
953610030 3:44439803-44439825 CCTTCTAGGGAAAGCAAAGCGGG + Exonic
954210215 3:49093079-49093101 GTTTCTAATGAAAGATAAGCAGG + Intronic
954977051 3:54706111-54706133 GCTTCTAGTCAAAGGAATGCTGG - Intronic
956288887 3:67640716-67640738 GGTTCTAATGAAAGAAAAAAAGG - Intronic
957496853 3:81004027-81004049 GCTTTTAGTGAAAGAGAAGTGGG + Intergenic
957653035 3:83034706-83034728 GATTATATTAAAAGAAAAGTAGG - Intergenic
958000816 3:87746559-87746581 GCTTCTAGGGGAAGAAAAGATGG + Intergenic
958659729 3:97050996-97051018 GCTTCTATTGAATGAAAATATGG + Intronic
958879777 3:99656657-99656679 GATTGTAAGGAAAGAAAAGCAGG - Intronic
959403204 3:105928637-105928659 GCTTCTTTTGAGTGAAAAGCTGG + Intergenic
959639364 3:108614980-108615002 GCTTCCATTGGAACAAAAACAGG + Intronic
961017857 3:123481320-123481342 GCTTCTCTTGAAAGAAGATGTGG - Intergenic
961600758 3:128059793-128059815 TGTTCTATTCAAAGAAAATCAGG - Intronic
962029795 3:131587873-131587895 CCTTCTAGTGAATGAAAACCTGG + Intronic
963064864 3:141255691-141255713 GCTCCTATGGAAAGAAGTGCAGG + Intronic
964113943 3:153115742-153115764 GCTGGTATTTGAAGAAAAGCTGG + Intergenic
964932194 3:162040210-162040232 GTTTCTATTAAAATGAAAGCTGG - Intergenic
966135978 3:176698599-176698621 GCTCCTCTTGAAAGTAAAGGAGG + Intergenic
966260076 3:177966131-177966153 GCTTCTTTTGAAAAAATGGCTGG - Intergenic
966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG + Intronic
967851387 3:194085234-194085256 TCTTCTTTTCAAAGAAAGGCAGG - Intergenic
968025779 3:195442120-195442142 GCTTAAGTGGAAAGAAAAGCAGG + Intronic
969401124 4:6956354-6956376 TCTTCTATTCCAAGAGAAGCTGG + Intronic
970256123 4:14171946-14171968 GCTTCCTTTGTAAGTAAAGCGGG + Intergenic
970921034 4:21395400-21395422 GCTTCTATAGGAAGAACAGATGG - Intronic
970934206 4:21549506-21549528 GCTTTTATTTAAAGCAAAGGGGG - Intronic
971125565 4:23750271-23750293 GCTTCTATTTCAAGAAAATCAGG - Intergenic
971779619 4:31015986-31016008 GCTTCTGGTGACAGAAAAGATGG + Intronic
972630782 4:40840050-40840072 GCATCAATAGAAAGATAAGCTGG - Intronic
973184662 4:47311483-47311505 GGTTCTTATGAAAGGAAAGCAGG + Intronic
974017199 4:56658034-56658056 GCTTCGCTTGAAAGAAAACAAGG + Intronic
976069161 4:81221540-81221562 GCTTCTCTAGAAAACAAAGCTGG - Intergenic
976234770 4:82884711-82884733 GGCTCTATTGAAAGGAAAGGAGG - Intronic
976504029 4:85825609-85825631 TCTTCAATTGAAAAACAAGCAGG + Intronic
978467048 4:109019128-109019150 GCTTCCAGTGAACAAAAAGCAGG + Intronic
978752974 4:112272834-112272856 TTATCTATTGAAAAAAAAGCGGG - Intergenic
980036287 4:127886061-127886083 GCCTCTATTGACAAAAAAGATGG - Exonic
980499944 4:133636702-133636724 GCTTTTATTAAAAAAAAAGAAGG + Intergenic
980535944 4:134123882-134123904 GCTGCAATTGAAAAAAAAGTTGG + Intergenic
981569252 4:146134260-146134282 CCCTCCATTGAAAGAACAGCTGG - Intergenic
981630582 4:146814411-146814433 GCTTCTATTTAAAAAAAAGTTGG + Intronic
982319159 4:154060936-154060958 GCTTCCTTTGGAAGTAAAGCAGG - Intergenic
984311991 4:178073296-178073318 GATTCCTTTGAAAAAAAAGCAGG + Intergenic
985393945 4:189521453-189521475 GCTTCTATGGAAAGAACAAGTGG - Intergenic
986162636 5:5244313-5244335 GCTTCTATAGAAAGTAATTCTGG - Intronic
987320558 5:16765257-16765279 GCTCCTAGTGAAAATAAAGCAGG + Intronic
990037866 5:51344805-51344827 GCTTGTATAGGAAGAAAAGTAGG - Intergenic
990288440 5:54324904-54324926 ACTTCTATTGAAAGAACCACAGG + Intergenic
990786710 5:59428873-59428895 TATTCTACTGAAAGAAAAGATGG + Intronic
991068063 5:62445085-62445107 GTATATATTGAAATAAAAGCTGG + Intronic
998494808 5:142579091-142579113 GCTTCTACTAACAGTAAAGCCGG + Intergenic
999398739 5:151248319-151248341 GCTTCAAATGCAAGAAAAGCGGG - Intronic
1000436583 5:161218013-161218035 CCTTCTATTCACAGAAAAGAGGG + Intergenic
1001247211 5:170113693-170113715 GCCTGAACTGAAAGAAAAGCAGG - Intergenic
1004743174 6:18483239-18483261 GCTTCTGTTGGAAGAAGAGAAGG + Intergenic
1004921272 6:20378460-20378482 TCTTCTATTGAGTGGAAAGCTGG - Intergenic
1006590958 6:35157308-35157330 GCATCTAATGAAAGAATACCAGG - Intergenic
1006634849 6:35454657-35454679 GAATCTATTTTAAGAAAAGCTGG + Intronic
1007400112 6:41598613-41598635 GGCTCTCTTCAAAGAAAAGCTGG - Intronic
1008508232 6:52251994-52252016 TCTTCTGATGAAAAAAAAGCCGG + Intergenic
1009890770 6:69678423-69678445 ACTTTTATTGAAAAAAAATCTGG + Intronic
1011572300 6:88751646-88751668 GTTTCTATTGAAAGAATACATGG + Intronic
1012928428 6:105291502-105291524 GCTTCTAGTGAATATAAAGCAGG + Intronic
1013949066 6:115757460-115757482 GCTTCTAGAGAAAGTAAAACAGG + Intergenic
1014229366 6:118885770-118885792 TCTTCTATAGAGAGAAAAGAGGG + Intronic
1014661216 6:124174757-124174779 CCAACTAATGAAAGAAAAGCAGG + Intronic
1014965853 6:127749430-127749452 GCTTATTTTGAAAGAAAATTTGG + Intronic
1016798849 6:148147518-148147540 CCTTGTATTGAAAGAAAGGCAGG - Intergenic
1019052453 6:169193471-169193493 GCTTCTATGCAAAGAGAAGCAGG + Intergenic
1020679843 7:11222805-11222827 TATTTTGTTGAAAGAAAAGCTGG + Intergenic
1020682685 7:11256526-11256548 GCTTCTAGAGAAAGGAATGCAGG + Intergenic
1023179029 7:37462638-37462660 GCTTGTATTAAAAAAAAAGAAGG - Intergenic
1024751627 7:52472645-52472667 GCTTGTTTTTAAAGAAAAGATGG + Intergenic
1024973251 7:55089862-55089884 GCTTGTATTGACAGGAAAGAGGG - Intronic
1026502978 7:70958623-70958645 GCTTCTTTTTAATGAAATGCAGG + Intergenic
1027820463 7:83036517-83036539 GCTTCTACGATAAGAAAAGCAGG - Intronic
1031452495 7:121938900-121938922 ACTACTATTGAGATAAAAGCAGG - Intronic
1032455395 7:132069514-132069536 GCTTCTGTTAAAAGAACAGCAGG + Intergenic
1033251675 7:139765926-139765948 GCTTTTCTTGAAAGATAAGGTGG - Intronic
1035094276 7:156340859-156340881 GCTTCTCTTGACAGAAAGGAGGG + Intergenic
1035408186 7:158614584-158614606 TCTTCTATTAAAAAATAAGCAGG - Intergenic
1038740262 8:30211075-30211097 TCATCTATAGAAAGAAAGGCAGG - Intergenic
1038746139 8:30257066-30257088 GCTGCTGTTTAAAGTAAAGCTGG + Intergenic
1039764920 8:40618505-40618527 GTTTGTATTGACAGAAAATCAGG + Intronic
1040789467 8:51209102-51209124 GTTTCTATGGAAACGAAAGCAGG - Intergenic
1040934890 8:52772219-52772241 GCTTCTCTTCAAAAAAAAGGAGG - Intergenic
1042045043 8:64641320-64641342 GATTCTTTTAAAAGAAAAACAGG - Intronic
1042714853 8:71761651-71761673 GCTTATAATAAAAGAAATGCTGG + Intergenic
1043140500 8:76582968-76582990 GCTGAAATGGAAAGAAAAGCTGG - Intergenic
1043418830 8:80078663-80078685 GCATTAATTGAAAGAAAAGAGGG - Intronic
1044737219 8:95291168-95291190 GGTTCTTTTGAAAAAAAAACTGG - Intergenic
1045630614 8:104117389-104117411 GCTTCTATTAAAAAAAAAAAAGG - Intronic
1045821611 8:106344684-106344706 GCTTCTACTGGGAGAAAGGCCGG - Intronic
1046027355 8:108740903-108740925 GTTTGTATTGGAAGAAAAGCTGG + Intronic
1048919259 8:139213076-139213098 GCATCTATTAAAAGAACAGAAGG + Intergenic
1049118579 8:140712944-140712966 GCTTTACTTGAAAGAACAGCTGG - Intronic
1049484164 8:142843128-142843150 ACCTCTATGGAAAGAAACGCAGG + Intronic
1050912709 9:11093278-11093300 GCTTCTTTTGTAAGAACAGATGG + Intergenic
1052470423 9:28887497-28887519 GCTTTTATTAAAAAAAAAGAAGG + Intergenic
1055342444 9:75298579-75298601 GCAGCTATAGAAAGAAAAGGAGG + Intergenic
1055344071 9:75315443-75315465 GCTACTATAGAAAGAAAGGAAGG - Intergenic
1055998077 9:82183529-82183551 GGCTCTGTTGAAAGAAAAGCTGG + Intergenic
1056289663 9:85129954-85129976 GCTTATAATGAAAGATAAGCAGG + Intergenic
1057013465 9:91629722-91629744 TCATATATTGAAACAAAAGCAGG - Intronic
1059455414 9:114397572-114397594 GCTTTTGTTGAAAGAAATGACGG - Intergenic
1062001178 9:134216474-134216496 GCTTCCATTGACATAACAGCTGG + Intergenic
1062188626 9:135233183-135233205 AATTCTAATAAAAGAAAAGCTGG + Intergenic
1186279223 X:7975022-7975044 GCTTCCATCGAATGTAAAGCAGG + Intergenic
1186279832 X:7979633-7979655 GCTTCTAGTGAATATAAAGCAGG + Intergenic
1187735357 X:22297731-22297753 GCAGCTATAGAAAGAAGAGCAGG + Intergenic
1188021578 X:25164311-25164333 ATTTCTTTAGAAAGAAAAGCTGG - Intergenic
1188401456 X:29750171-29750193 GTTTCTATTTTAAGAAAAGCTGG + Intronic
1190254116 X:48749769-48749791 GCTACTATTGAAAAAAAAACAGG + Intergenic
1190578556 X:51867769-51867791 TCTTCTGTGGACAGAAAAGCAGG + Intronic
1194475142 X:94348992-94349014 CCTTCTATTAGTAGAAAAGCAGG + Intergenic
1194681163 X:96854996-96855018 GCTTAGATTTAAAGAAAAGATGG - Intronic
1197580839 X:128281468-128281490 GTCTCTATTTTAAGAAAAGCAGG + Intergenic
1198160803 X:134006021-134006043 GATTCTAGTGACAGAAAAGAAGG + Intergenic