ID: 1078351449

View in Genome Browser
Species Human (GRCh38)
Location 11:10598082-10598104
Sequence CTATATCCTCAGATGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078351449_1078351453 4 Left 1078351449 11:10598082-10598104 CCAAATTCCATCTGAGGATATAG 0: 1
1: 0
2: 2
3: 9
4: 192
Right 1078351453 11:10598109-10598131 TGGACGCCCTTAACTTTCTGTGG 0: 1
1: 0
2: 0
3: 2
4: 53
1078351449_1078351454 5 Left 1078351449 11:10598082-10598104 CCAAATTCCATCTGAGGATATAG 0: 1
1: 0
2: 2
3: 9
4: 192
Right 1078351454 11:10598110-10598132 GGACGCCCTTAACTTTCTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078351449 Original CRISPR CTATATCCTCAGATGGAATT TGG (reversed) Intronic
901326767 1:8371342-8371364 CTATACACTAAGATGGAGTTAGG + Intronic
903970071 1:27113043-27113065 CTATATCTTAAGTTAGAATTCGG - Intronic
905787729 1:40771276-40771298 TTCTGCCCTCAGATGGAATTAGG + Intronic
908082898 1:60599408-60599430 GTAATGCCTCAGATGGAATTTGG - Intergenic
908807545 1:67946721-67946743 CTCTATACTCAGTTGGACTTGGG + Intergenic
911337015 1:96593650-96593672 TTACCTCCTCAGATGGACTTTGG - Intergenic
911818715 1:102388287-102388309 CTTTCTGCTCACATGGAATTTGG + Intergenic
912114660 1:106390498-106390520 ATATATCCTCAGAAGGACATAGG - Intergenic
916086140 1:161270916-161270938 CTATATCCTCACATGGTAGAAGG - Intronic
917614553 1:176726760-176726782 ACATATTCTGAGATGGAATTTGG + Intronic
921349297 1:214219163-214219185 CTGAACCCTCAGATGGAATGAGG + Intergenic
923707332 1:236354813-236354835 CTTTAAACTGAGATGGAATTTGG - Intronic
1063510289 10:6638078-6638100 CTATTTGCTCAGATGCATTTTGG - Intergenic
1064228838 10:13511646-13511668 ATATATCCTTAAAAGGAATTTGG + Intronic
1064603415 10:17015446-17015468 CTACCTCCTCAGTTGTAATTGGG - Intronic
1064723020 10:18249121-18249143 CTATTTTCTCAGATGAAATTAGG - Intronic
1066274956 10:33859646-33859668 CTACAGCCTCAGATGGCCTTGGG - Intergenic
1067116315 10:43437706-43437728 CTATTTCCTCAGAAGGAACTGGG - Intronic
1069778072 10:70938304-70938326 CTGGATCCTCAGATCGATTTGGG - Intergenic
1070417528 10:76204582-76204604 CAATGTCCTCAGATGGTATAGGG + Intronic
1070828768 10:79406156-79406178 CTATTTCCTCACCTGGAAATGGG - Intronic
1071639129 10:87288266-87288288 CTGTTTCCTCAGCTGCAATTGGG - Intergenic
1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG + Intergenic
1071835012 10:89409759-89409781 CCACCTCCTCAGATGTAATTGGG + Intronic
1074460074 10:113628812-113628834 CTCTATCCTCAGATTTATTTTGG - Intronic
1075950230 10:126470916-126470938 CTATTTCCTCACGTGGGATTGGG + Intronic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1081288406 11:41301723-41301745 CTCTCTCCTCTGATGAAATTGGG - Intronic
1084527705 11:69706930-69706952 CTACACCCTCAGATGGAAGAAGG - Intergenic
1088354049 11:108922926-108922948 CTAGATCCTTAAATGGAGTTTGG - Intronic
1095107789 12:38256605-38256627 CAATCTCCACAGATTGAATTGGG - Intergenic
1095530064 12:43176504-43176526 CTTTTTCCTCTGATGGAATCTGG - Intergenic
1095660186 12:44723403-44723425 CTATGTTATCTGATGGAATTTGG + Intronic
1097644483 12:62220396-62220418 CTATATCCTCACCAGGATTTGGG - Intronic
1099677038 12:85774062-85774084 CCATATCCTCAGAAGCAAGTGGG + Intergenic
1101919917 12:108924105-108924127 CTGTGTCCTCAGATGGCATAAGG - Intronic
1102879496 12:116473519-116473541 CTGTATCCTCACATGGAAGAAGG - Intergenic
1105267291 13:18832531-18832553 CTTTATCCTCAGAGTTAATTGGG - Intergenic
1105791469 13:23804014-23804036 CTATTTTCTCAAAAGGAATTAGG + Intronic
1110136504 13:72073777-72073799 CTGTATCCTCACATGGAAGCGGG - Intergenic
1111500434 13:89112842-89112864 ATATAACCACAAATGGAATTAGG - Intergenic
1113203764 13:107893925-107893947 CTACCTCCTCAGTTGTAATTGGG - Intergenic
1114173159 14:20295047-20295069 CTATATCCATAGTTGAAATTTGG - Intronic
1114766832 14:25382251-25382273 CTATATCCTCACATGGCAAAGGG + Intergenic
1117263334 14:54059647-54059669 CTATAGCCTCTGATGGATCTGGG - Intergenic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1118912115 14:70070111-70070133 CTATATCTTGAGAGGGACTTTGG + Intronic
1121724297 14:96135322-96135344 AGATATCCTGAGATGGAAATGGG - Intergenic
1121873391 14:97429815-97429837 CTATGTCCTCAGATGGCAGAAGG + Intergenic
1202831478 14_GL000009v2_random:38954-38976 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1131839420 15:96419778-96419800 ATTTATCCTCAGATGGTGTTCGG + Intergenic
1202979688 15_KI270727v1_random:340180-340202 CAATCTCCTAAGATTGAATTAGG - Intergenic
1133674098 16:8053681-8053703 CTAAATCCTGAGTTGGAATACGG - Intergenic
1134911494 16:18030998-18031020 TTATTTCCTCAAATGAAATTGGG - Intergenic
1139385806 16:66569461-66569483 CTAAATTCTCAGATGTAGTTCGG - Intronic
1144215661 17:13052993-13053015 CTATATTCTGAGAAGGGATTTGG + Intergenic
1144647108 17:16982557-16982579 CAATATATTCAGATGGAATAAGG + Intergenic
1147723765 17:42554187-42554209 TTGTAGCCTCAGATGGATTTGGG + Intronic
1149056999 17:52378619-52378641 CTAAATCCTCAGATACAGTTTGG + Intergenic
1154421119 18:14228899-14228921 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1155008877 18:21755170-21755192 CCATTTCCTCAGATGGAACTAGG + Intronic
1156345275 18:36251593-36251615 CTATGTCCTCAGATTGGATCTGG + Intronic
1159336331 18:67071943-67071965 TTTTATCCTCAGGAGGAATTGGG - Intergenic
1161323115 19:3650283-3650305 CTATTTCCTCAGCTGGAAACAGG + Intronic
1164803297 19:31095947-31095969 CTTTGTCCTCAGATGCTATTGGG - Intergenic
1167730972 19:51254897-51254919 CTAGATACTCACATGGAAATTGG + Intronic
1202641218 1_KI270706v1_random:88786-88808 CTTTATCCTCAGAGTTAATTGGG - Intergenic
925655268 2:6140797-6140819 ATATATTTTCAGATTGAATTTGG + Intergenic
925765154 2:7226275-7226297 CTAAAGCCTCAGATCGACTTGGG - Intergenic
931533096 2:63239374-63239396 CTATATTCTCAAGGGGAATTTGG - Intronic
931902696 2:66807134-66807156 CTATCTTCTTTGATGGAATTGGG - Intergenic
934014294 2:87862529-87862551 CTATATCCTCACATGGTAGAAGG - Intergenic
935065934 2:99647796-99647818 CTTTATCCTCAAATGTAATAGGG - Intronic
935660024 2:105458675-105458697 CTATAACCTCACATGGTATAAGG + Intergenic
937967835 2:127527290-127527312 CGATATCATCAGCGGGAATTTGG - Intergenic
939259102 2:139783947-139783969 TTTTATCCTTAGATGGAGTTGGG + Intergenic
939994694 2:148908966-148908988 ATATATGCTCAGGTGAAATTTGG - Intronic
940121086 2:150266850-150266872 CTATGTCCTCAGATGGCAGAAGG + Intergenic
940259158 2:151762739-151762761 ATTTATCCTTAGATGGAAATAGG + Intergenic
945000626 2:205346283-205346305 CCATATTGTCAGATGGAATATGG - Intronic
947109964 2:226708068-226708090 TTATATCCACAGAGGGACTTGGG - Intergenic
947466803 2:230358084-230358106 CCATTTCCTCAGCTGGAAGTAGG - Intronic
1169639845 20:7739574-7739596 CTATATCCTCACTTGGAAGAAGG + Intergenic
1169658050 20:7947667-7947689 CAATTTCCTGAGATTGAATTAGG - Intergenic
1169958443 20:11131855-11131877 CAGTATCCTCAGATGGAATGAGG + Intergenic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1170831102 20:19841383-19841405 CTATAACCTCACCTGGAGTTGGG + Intergenic
1171888320 20:30679003-30679025 CTTTATCCTCAGAGTTAATTGGG - Intergenic
1172661189 20:36570218-36570240 CTTTATCCTGAGATGCAACTTGG + Intergenic
1174933777 20:54845069-54845091 CTATAATTCCAGATGGAATTTGG - Intergenic
1176104899 20:63381317-63381339 CTTTCTCCTCTGATGGAAGTCGG - Intergenic
1176610665 21:8883785-8883807 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1176852355 21:13931062-13931084 CTTTATCCTCAGAGTTAATTGGG - Intergenic
1177003968 21:15648032-15648054 CTATATCCTCACATGGCAGAAGG - Intergenic
1177351758 21:19952119-19952141 CTATATCTTTAGTTGTAATTGGG + Intergenic
1177636445 21:23793347-23793369 ACATATCCTCAGAAGGATTTGGG + Intergenic
1180360742 22:11893089-11893111 CTTTATCCTCAGAGTTAATTGGG + Intergenic
949603271 3:5624955-5624977 CTATATCCTCAAATGGCAAAAGG - Intergenic
949815390 3:8052855-8052877 CTCTAACCTCAGAAGGAATCTGG - Intergenic
952996181 3:38884678-38884700 CTATATCCACTCAAGGAATTAGG + Intronic
954494043 3:50935696-50935718 CTATCTCCTCAGTTTGAGTTTGG - Intronic
955478704 3:59366954-59366976 CTATGTCCTCAGATGGCAAAAGG - Intergenic
957180802 3:76875150-76875172 CTATATCCTCACATGGCAGAAGG - Intronic
957816636 3:85308623-85308645 CTATTTCCACAGGTGGTATTGGG - Intronic
958500512 3:94901186-94901208 CCATATCTTCACAAGGAATTTGG + Intergenic
958642698 3:96828291-96828313 TTATCTCCTCTGAAGGAATTAGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960175124 3:114508588-114508610 CTATATCTAAAGATGGACTTTGG + Intronic
960188002 3:114667922-114667944 CTCAATCCTCAAATGGAAATGGG + Intronic
962196205 3:133365757-133365779 CTATATCCCCGGCTGGAATGGGG + Intronic
1202737348 3_GL000221v1_random:18571-18593 CTTTATCCTCAGAGTTAATTGGG + Intergenic
970067295 4:12113128-12113150 CAATATCCAAAGATGGAATCAGG - Intergenic
970441742 4:16085987-16086009 CTATTTCCTCTGAGGGAAATTGG - Intergenic
972133152 4:35861772-35861794 CTACCTCCTCAGTTGTAATTGGG - Intergenic
972368567 4:38399179-38399201 CTACATCCTCACTTGGTATTAGG + Intergenic
972518920 4:39835389-39835411 CAATATCATCAAATGGCATTTGG - Intronic
973384731 4:49499313-49499335 CTTTATCCTCAGAGTTAATTGGG - Intergenic
973918357 4:55659439-55659461 ATAGATTCTCAGAAGGAATTTGG - Intergenic
974537270 4:63188021-63188043 CTACCTCCTCAGTTGTAATTGGG + Intergenic
974841269 4:67302221-67302243 CCATATCCTAAGATTGCATTTGG - Intergenic
975977248 4:80113359-80113381 CCAGATTCTGAGATGGAATTAGG + Intronic
976399924 4:84596059-84596081 CTCTATCCCCAAATGGAATCGGG - Intronic
979192671 4:117881974-117881996 CAAGATGCTCAGATGGAATATGG + Intergenic
979745106 4:124203341-124203363 CTATATTCTCAGTTTAAATTGGG + Intergenic
980822970 4:138040139-138040161 CTCCATCATCAGATGGAACTGGG - Intergenic
980985710 4:139692350-139692372 CTGTATTCCCAGAAGGAATTGGG - Intronic
981537603 4:145816023-145816045 CAAAGTCCTCAAATGGAATTTGG + Intronic
982150152 4:152445267-152445289 TTACATCTTCAGATGAAATTTGG + Intronic
987161023 5:15142834-15142856 CTGTATCCTCAGATTCAATCAGG + Intergenic
988866094 5:35336967-35336989 CTAAAACCTCAAATGGAATTTGG - Intergenic
991357512 5:65784527-65784549 CTATATCCTCACATGGCAGAAGG + Intronic
995433904 5:112114042-112114064 CTCTATCCTCAGCTGAGATTTGG - Intergenic
996081223 5:119260459-119260481 CTGTATCCTCACATGGTCTTTGG - Intergenic
996457919 5:123706343-123706365 CTCTATCCTACGAGGGAATTTGG + Intergenic
998402546 5:141855541-141855563 CTCTATCCTCAGATGAAATTGGG + Intronic
998847458 5:146324952-146324974 CTAGGTCCTGAGATGGAAATGGG - Intronic
1003805913 6:9725690-9725712 CTACCTCCTCAGTTGTAATTGGG + Intronic
1004078152 6:12364185-12364207 CTTTTTCCTCAGATGCCATTAGG - Intergenic
1008601479 6:53100423-53100445 AGATATCCTCAGAGGGAATCTGG + Exonic
1009287314 6:61836484-61836506 CTATCTACTCAGATAAAATTAGG + Intronic
1011087776 6:83561637-83561659 TTATATCCTCTAATGGTATTGGG + Intronic
1012538050 6:100323260-100323282 CAATATTCTGAGATGGAATCAGG - Intergenic
1014199135 6:118589352-118589374 GAATATCCTCAGATGGCTTTCGG + Intronic
1014955783 6:127614335-127614357 TTATATACTGAGATGGAGTTCGG + Intergenic
1017338992 6:153298335-153298357 CTAGTTCTTCAGATGGAAGTAGG + Intergenic
1020612126 7:10411564-10411586 GTGTAACATCAGATGGAATTTGG + Intergenic
1020853919 7:13393109-13393131 CTAGCTCCTCAGTTAGAATTTGG - Intergenic
1021497672 7:21293941-21293963 CTATATCATCACATGGCAGTTGG + Intergenic
1022171500 7:27836341-27836363 CTGTCCCCTCTGATGGAATTAGG + Intronic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1030906524 7:115190270-115190292 CTATTTCCACAGATAAAATTTGG - Intergenic
1030939164 7:115623734-115623756 CTATATCCTCAGGGCCAATTGGG - Intergenic
1031706831 7:124991327-124991349 GTAGATGCTCAGATGGAGTTTGG - Intergenic
1036495096 8:9263100-9263122 TTATATCCTCTGCTGGAATGTGG + Intergenic
1036619755 8:10416717-10416739 CTCTAACCTCACATGGGATTCGG + Intronic
1039416200 8:37396388-37396410 CTTTATCCTCAGCTGGATGTGGG + Intergenic
1039550022 8:38436657-38436679 CTATCCCCTAAGAAGGAATTAGG + Intronic
1039977118 8:42376579-42376601 TTATTTCCTCATCTGGAATTAGG + Intronic
1043378210 8:79673644-79673666 CTGTTTCCTCAGATGTAAATTGG + Intergenic
1045133350 8:99183404-99183426 TGAAATGCTCAGATGGAATTGGG + Intronic
1046615587 8:116473825-116473847 TTATATCCTCAGAAGAGATTAGG + Intergenic
1046622267 8:116540771-116540793 ATATTCCCTCAAATGGAATTGGG - Intergenic
1052397937 9:27963784-27963806 TTATAGCCTCAGATGTATTTTGG - Intronic
1052874949 9:33551765-33551787 CTCTATCCTCAGAGTTAATTGGG + Intronic
1053189383 9:36049131-36049153 CTATGTCCTCTTATGGAATCAGG + Intronic
1053227744 9:36375526-36375548 CTGTATCCTCAAAGGCAATTAGG - Intronic
1053501071 9:38592558-38592580 CTCTATCCTCAGAGTTAATTGGG - Intergenic
1053660122 9:40268244-40268266 CTTTATCCTCAGAGTTAATTGGG + Intronic
1053910496 9:42897599-42897621 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1054361116 9:64120954-64120976 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1054372255 9:64414548-64414570 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1054524476 9:66107973-66107995 CTTTATCCTCAGAGTTAATTGGG - Intronic
1054679873 9:67904245-67904267 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1055467988 9:76584257-76584279 GTAAAGCCTCAGATGGAAGTAGG - Intergenic
1056488593 9:87083693-87083715 TTCTACCCTCAGATTGAATTAGG - Intergenic
1057406894 9:94780367-94780389 CTCTGTCCTCAACTGGAATTTGG - Intronic
1058576218 9:106405454-106405476 CTATATCCTCATAGGGGCTTGGG + Intergenic
1061339237 9:129965907-129965929 TTATATCCTCAGAAGGGATCAGG - Intronic
1203693479 Un_GL000214v1:68510-68532 CTTTATCCTCAGAGTTAATTGGG - Intergenic
1203706071 Un_KI270742v1:49021-49043 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1203557929 Un_KI270744v1:16877-16899 CTTTATCCTCAGAGTTAATTGGG - Intergenic
1203642794 Un_KI270751v1:35553-35575 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1186188756 X:7048059-7048081 ATAAATCCTCAGATGGAGTTTGG - Intergenic
1187499996 X:19831826-19831848 ATGTGTCCCCAGATGGAATTGGG - Intronic
1187519451 X:20000755-20000777 TTATATCCTCAGCAGGATTTGGG - Intergenic
1187830192 X:23373449-23373471 CTATATCCACAGCTTAAATTTGG + Intronic
1188715846 X:33458012-33458034 CCATTTCCTCAGATGGAAATAGG - Intergenic
1188734816 X:33700000-33700022 CTATATCGTGACATGGAAGTTGG + Intergenic
1192098058 X:68234185-68234207 CTTTATCCTCGCATGGATTTTGG + Intronic
1193263933 X:79445086-79445108 TAATATCCTCACAAGGAATTGGG + Intergenic
1193691402 X:84649182-84649204 CTATATCTTCATATGGATTTTGG - Intergenic
1194846192 X:98812151-98812173 CTATATCCTCACATGGCAAAAGG - Intergenic
1195850909 X:109280615-109280637 CTACCTCCTCAGTTGTAATTGGG - Intergenic
1196020896 X:110989949-110989971 CAATATCCTCAGTTGAGATTGGG - Intronic
1196504348 X:116423894-116423916 AGATATCCTCAGATAGAATAAGG + Intergenic
1197456621 X:126683945-126683967 CTAGATTCTGAGATGGAGTTAGG - Intergenic
1199473995 X:148226137-148226159 CTGGTTCCTCAGATGGAGTTAGG + Intergenic
1199949427 X:152695647-152695669 CTATGTCCTCACATGGAAGAAGG - Intergenic
1199960249 X:152772802-152772824 CTATGTCCTCACATGGAAGAAGG + Intergenic
1200780738 Y:7213207-7213229 CTATTTCATCAGATTGAAATAGG - Intergenic
1200800910 Y:7386499-7386521 CCACCTCCTCAGTTGGAATTGGG - Intergenic
1200959416 Y:8983258-8983280 CAATCTCCTCAGGTGTAATTGGG + Intergenic
1201496287 Y:14594002-14594024 CCATCTCCTCAGTTGTAATTGGG - Intronic