ID: 1078351574

View in Genome Browser
Species Human (GRCh38)
Location 11:10599449-10599471
Sequence CTTCCAACACTGACGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078351571_1078351574 -1 Left 1078351571 11:10599427-10599449 CCTTTGGCGGCAACTTCCTCAGC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1078351574 11:10599449-10599471 CTTCCAACACTGACGGAAAATGG 0: 1
1: 0
2: 0
3: 8
4: 95
1078351569_1078351574 14 Left 1078351569 11:10599412-10599434 CCACGCATTAGGATTCCTTTGGC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1078351574 11:10599449-10599471 CTTCCAACACTGACGGAAAATGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078351574 Original CRISPR CTTCCAACACTGACGGAAAA TGG Intronic
903555618 1:24191022-24191044 CCTCCAACAGTGAGGGAAATTGG - Intergenic
904007729 1:27372633-27372655 CTGCCGGCACTGACGGAACATGG - Intronic
905693899 1:39961176-39961198 CTTCCTACACTGAAAGGAAAGGG - Intronic
906275875 1:44515150-44515172 CTTCAAACATTGAGGCAAAATGG - Intronic
909872534 1:80761005-80761027 CTAACAACACTGAAGGAAAAAGG - Intergenic
1063539185 10:6914835-6914857 ATTCAGACACTGAGGGAAAAAGG + Intergenic
1066607747 10:37198641-37198663 CTTCCAAAAATGAGTGAAAACGG + Intronic
1068262530 10:54600896-54600918 CTTCCAACAGTGCAGGAAATTGG - Intronic
1068321693 10:55426627-55426649 CTTCCAACAGCGAGGGCAAAGGG + Intronic
1070485317 10:76924907-76924929 TTTCCAACACAGAGGGAAAGTGG + Intronic
1078351574 11:10599449-10599471 CTTCCAACACTGACGGAAAATGG + Intronic
1078367100 11:10715772-10715794 CTTCCAACTCTGCCGGGAAATGG + Intergenic
1082712616 11:56571693-56571715 CTTCAAACACTGAACAAAAAAGG - Intergenic
1082964451 11:58951577-58951599 CTTCCAAAATTGTCGAAAAATGG - Intronic
1086841637 11:91692706-91692728 CTTCCTACACTGAGGAAAAAGGG + Intergenic
1091077480 11:132633833-132633855 CTTCCAACACCAACTAAAAAGGG + Intronic
1094358568 12:29605548-29605570 CTACCAAAACTGACCAAAAAGGG + Intronic
1094656151 12:32421074-32421096 CTACCAACACTGTCAGAAAGTGG + Intronic
1094748433 12:33375517-33375539 CTTCCAACAGGGCCTGAAAATGG + Exonic
1097670690 12:62533918-62533940 GTTCCAACACTGTTGGAGAAGGG - Intronic
1100915207 12:99412528-99412550 CATCCAACACTGGTGGAAGAGGG - Intronic
1101244735 12:102874793-102874815 TTTCCAAGACAGAGGGAAAATGG - Intronic
1101707008 12:107230141-107230163 CTGCCAACATTGACAGGAAAAGG + Intergenic
1104768981 12:131348563-131348585 CTCCCCACACTGAAGGCAAATGG + Intergenic
1105703130 13:22948653-22948675 CTTCCCACCCTGAAAGAAAAAGG + Intergenic
1108316581 13:49242848-49242870 CTTCCACCAGTGAGGGCAAAGGG - Intergenic
1110076102 13:71245238-71245260 CTTCCCAGACTGTCAGAAAAGGG + Intergenic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1110938336 13:81319462-81319484 CTTCCACCAGTGAGGGCAAAAGG - Intergenic
1113192943 13:107771570-107771592 TTCCCAACACTGACTCAAAATGG - Intronic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1120637183 14:86966834-86966856 CGGCCAACACTTAGGGAAAATGG + Intergenic
1123699138 15:22901905-22901927 CTACCAACACTCACGGAAGGTGG + Intronic
1125438118 15:39669973-39669995 CTTCCAACCCTCCCGGAAACTGG + Intronic
1132200101 15:99945994-99946016 CTTTCAACACACACAGAAAAAGG - Intergenic
1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG + Intergenic
1136646585 16:31624398-31624420 CTGCCAACACTGACTGGAATGGG + Intergenic
1151121140 17:71794473-71794495 CTTTCAGCTCTGACTGAAAATGG + Intergenic
1153989925 18:10387333-10387355 ATTCCAACACTCACTGAACAAGG + Intergenic
1159777484 18:72620216-72620238 CTTCCACTACTGAGGGCAAAGGG + Intronic
1162027059 19:7900397-7900419 CTTCCAGCACTGCCGGAAGCTGG + Exonic
926845198 2:17129255-17129277 CTGCCAACACTCAAGGAAAAAGG + Intergenic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
936691238 2:114891783-114891805 CTTCAATCACTCAAGGAAAAAGG - Intronic
936820542 2:116514663-116514685 CTTCCAACAATGAAAGAAAAAGG + Intergenic
937533183 2:122854575-122854597 ATTCCAACACTGCCTGACAAGGG - Intergenic
942997228 2:182277334-182277356 CAGCCAACACTTAGGGAAAATGG + Intronic
943886587 2:193225621-193225643 CATCCAACACTGGAGAAAAATGG + Intergenic
944531823 2:200674733-200674755 CTTCCAACACAGACCAAAACTGG + Intronic
948761480 2:240194600-240194622 CTTCCAACACTGCCCCACAATGG - Intergenic
1169796801 20:9471559-9471581 TATCCAAAACTGACTGAAAATGG + Intronic
1169918779 20:10710829-10710851 CTTCCTACACTTTAGGAAAATGG - Intergenic
1172220287 20:33269396-33269418 CCTCCAACAATGACTGTAAAAGG + Intergenic
1175819660 20:61901896-61901918 CTTCCACCTCTGACGGACAGTGG - Intronic
1177962062 21:27679791-27679813 CCTCCACCAGTGAGGGAAAAGGG + Intergenic
949743938 3:7266918-7266940 CTTCCAACCCTGAAGTCAAAGGG - Intronic
949769531 3:7564282-7564304 CCTCCTACACTTACTGAAAAAGG - Intronic
951077804 3:18418040-18418062 CTTCCAATGATAACGGAAAAGGG + Intronic
952455228 3:33466295-33466317 CTTCCAACAAGGAGAGAAAAGGG + Intergenic
954171360 3:48805298-48805320 CTTGTAACACTGACAGGAAATGG - Intronic
955115835 3:56000667-56000689 CTTCCAGCACTGATTAAAAATGG - Intronic
959601999 3:108197702-108197724 CTCCCAAGACTCAAGGAAAAGGG + Intronic
959773268 3:110125486-110125508 CTTCCACCAGTGAGGGCAAAGGG - Intergenic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
963793059 3:149604234-149604256 CTGCCAACACTGCCAGACAATGG + Intronic
973157222 4:46971188-46971210 CTTCCACCTCAGACGGAAGATGG - Exonic
976610812 4:87028692-87028714 CTTCTCACACTGAAGGAAAGTGG + Intronic
983576061 4:169263148-169263170 CTACAAACACTGACGGACAAAGG - Intronic
984689141 4:182706033-182706055 GTTCCAACACTGACAGTTAAAGG - Intronic
984926681 4:184813277-184813299 CTTCCAATACTGATTGAATAAGG + Intronic
985806639 5:2049215-2049237 CTTCCAGCTCTGAAGGAACACGG - Intergenic
986676833 5:10193196-10193218 TTTCAAGCACTGAAGGAAAAGGG + Intergenic
988586020 5:32508207-32508229 CTTCCAGCTCTGATGGAAAACGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
997840477 5:137234919-137234941 CTTACAACACTGACATTAAAGGG + Intronic
1003302108 6:4893174-4893196 CGTCCAAGAATGACTGAAAAGGG - Intronic
1004617058 6:17300771-17300793 CTTCCAACTGTGGCGGACAATGG + Intergenic
1007128899 6:39450958-39450980 CTTTCACTACTGACGAAAAAAGG - Intronic
1007351319 6:41275614-41275636 TTTCCAACACTCCCAGAAAAGGG - Exonic
1008490290 6:52079332-52079354 TTTCCAACACTGAACCAAAAGGG - Intronic
1010216292 6:73404935-73404957 CTTCCTGCAGTGATGGAAAATGG + Intronic
1014987556 6:128030226-128030248 CAGCTAACACTGACGGAAACTGG + Intronic
1017983296 6:159421439-159421461 CTTCCACCACCGATGGAGAATGG - Intergenic
1019690766 7:2410305-2410327 CTTCCTGCACTGACTTAAAAGGG - Intronic
1021089714 7:16468906-16468928 CTTCCCACACTGAAGAAAAGGGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024776183 7:52789195-52789217 TTTCCCACACTGGCAGAAAAAGG - Intergenic
1030258612 7:107539756-107539778 CTTCTAACAATGATGGAATAGGG + Intronic
1032754574 7:134876655-134876677 CTTCCAAAATTGATAGAAAATGG - Intronic
1033123529 7:138687153-138687175 GTTCCAACAATGTCTGAAAAGGG - Intronic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1039105250 8:33982887-33982909 CTTCTAACATTTAGGGAAAAAGG - Intergenic
1041320825 8:56610842-56610864 TTTCCAGCACTGAGGGTAAAGGG + Intergenic
1041717138 8:60942724-60942746 CTGCCTACACTCAAGGAAAAGGG + Intergenic
1045132693 8:99174414-99174436 CCTGCAACAGTGATGGAAAAAGG + Intronic
1046207706 8:111023158-111023180 CTTCCAACACTGAAATATAATGG + Intergenic
1046824503 8:118672576-118672598 CTTCATACACTGATGGAAATTGG - Intergenic
1051332230 9:16034430-16034452 CTTCCCACAATGAAGTAAAAAGG - Intronic
1058620868 9:106881306-106881328 CTACCAATACTGACAGAAAAGGG - Intronic
1059699986 9:116765987-116766009 CTTTCAATACTGAGTGAAAAGGG + Intronic
1194176183 X:90651244-90651266 CCTCCACCACTGAGGGGAAAGGG + Intergenic
1199388226 X:147248173-147248195 CTTTCATCACTGACTGTAAAAGG + Intergenic
1202328829 Y:23722979-23723001 CAACCAACACTTAAGGAAAATGG + Intergenic
1202541942 Y:25947075-25947097 CAACCAACACTTAAGGAAAATGG - Intergenic