ID: 1078354775

View in Genome Browser
Species Human (GRCh38)
Location 11:10625477-10625499
Sequence AAGTCCATCTGCAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 329}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078354775_1078354782 17 Left 1078354775 11:10625477-10625499 CCTTCACACTTGCAGATGGACTT 0: 1
1: 0
2: 1
3: 12
4: 329
Right 1078354782 11:10625517-10625539 GCATCAGGAAGGAAGGCTTGGGG 0: 1
1: 0
2: 1
3: 30
4: 334
1078354775_1078354778 6 Left 1078354775 11:10625477-10625499 CCTTCACACTTGCAGATGGACTT 0: 1
1: 0
2: 1
3: 12
4: 329
Right 1078354778 11:10625506-10625528 TTTGTTAACAGGCATCAGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 172
1078354775_1078354779 10 Left 1078354775 11:10625477-10625499 CCTTCACACTTGCAGATGGACTT 0: 1
1: 0
2: 1
3: 12
4: 329
Right 1078354779 11:10625510-10625532 TTAACAGGCATCAGGAAGGAAGG 0: 1
1: 0
2: 2
3: 24
4: 254
1078354775_1078354784 29 Left 1078354775 11:10625477-10625499 CCTTCACACTTGCAGATGGACTT 0: 1
1: 0
2: 1
3: 12
4: 329
Right 1078354784 11:10625529-10625551 AAGGCTTGGGGGCATCACAAAGG 0: 1
1: 0
2: 0
3: 7
4: 125
1078354775_1078354780 15 Left 1078354775 11:10625477-10625499 CCTTCACACTTGCAGATGGACTT 0: 1
1: 0
2: 1
3: 12
4: 329
Right 1078354780 11:10625515-10625537 AGGCATCAGGAAGGAAGGCTTGG 0: 1
1: 0
2: 3
3: 53
4: 470
1078354775_1078354777 2 Left 1078354775 11:10625477-10625499 CCTTCACACTTGCAGATGGACTT 0: 1
1: 0
2: 1
3: 12
4: 329
Right 1078354777 11:10625502-10625524 AGCTTTTGTTAACAGGCATCAGG 0: 1
1: 0
2: 0
3: 17
4: 122
1078354775_1078354776 -5 Left 1078354775 11:10625477-10625499 CCTTCACACTTGCAGATGGACTT 0: 1
1: 0
2: 1
3: 12
4: 329
Right 1078354776 11:10625495-10625517 GACTTAAAGCTTTTGTTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1078354775_1078354783 18 Left 1078354775 11:10625477-10625499 CCTTCACACTTGCAGATGGACTT 0: 1
1: 0
2: 1
3: 12
4: 329
Right 1078354783 11:10625518-10625540 CATCAGGAAGGAAGGCTTGGGGG 0: 1
1: 0
2: 0
3: 36
4: 453
1078354775_1078354781 16 Left 1078354775 11:10625477-10625499 CCTTCACACTTGCAGATGGACTT 0: 1
1: 0
2: 1
3: 12
4: 329
Right 1078354781 11:10625516-10625538 GGCATCAGGAAGGAAGGCTTGGG 0: 1
1: 0
2: 4
3: 32
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078354775 Original CRISPR AAGTCCATCTGCAAGTGTGA AGG (reversed) Intronic
900841068 1:5048976-5048998 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
902051193 1:13564834-13564856 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
902970088 1:20042118-20042140 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
903454324 1:23476661-23476683 AAGGCCATATTCAAGTTTGATGG - Intronic
904394231 1:30207362-30207384 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
904629909 1:31833245-31833267 TAGTCCATCTTCCAGTCTGAGGG + Intergenic
905060204 1:35133690-35133712 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
906925356 1:50110142-50110164 GAATCCATCTCCAAGTGTAATGG + Intronic
909136553 1:71807785-71807807 AAGCTCATCTGCAACTGAGAGGG + Intronic
909259987 1:73475333-73475355 AAGCCCATTTTCAAGTATGAAGG + Intergenic
909729772 1:78876794-78876816 TAGTCCCTTTGCAAGGGTGAGGG - Intergenic
911147687 1:94568451-94568473 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
912815033 1:112822196-112822218 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
912939173 1:114029979-114030001 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
913095440 1:115511767-115511789 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
914777414 1:150750422-150750444 CAGTCCACCTGAAAGTCTGAGGG - Intronic
916339058 1:163708056-163708078 AAGTCGATATGCAAGGGAGAGGG - Intergenic
917710790 1:177681933-177681955 AAGTCTATCTGCACATGTTAGGG - Intergenic
918302409 1:183216307-183216329 AAGACCATCTGAAAGGGTCAGGG - Intronic
919476677 1:198038856-198038878 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
919703597 1:200655610-200655632 AAGTCCAAGTGCATGTGTGCAGG - Intronic
921809534 1:219496919-219496941 GAGTCCAAAAGCAAGTGTGAGGG + Intergenic
922845128 1:228678682-228678704 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
923260350 1:232262018-232262040 AAGAGGATCTGCAAGTGTGCGGG + Intergenic
923841882 1:237681707-237681729 AAGGCCATGTTCAAGTGGGAAGG - Intronic
924152060 1:241139611-241139633 ATTCCCATCAGCAAGTGTGAGGG + Intronic
924707150 1:246510370-246510392 AAGGCCCTCTGCAAGGGGGATGG - Intergenic
924895899 1:248337817-248337839 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1063172930 10:3526021-3526043 GAGTACATCTGCAACTGAGATGG + Intergenic
1063200604 10:3782967-3782989 ATGGCCATCTGCTATTGTGAAGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066103115 10:32135405-32135427 TAGTCCCTTTGCAAGAGTGATGG + Intergenic
1069710081 10:70482405-70482427 AAGTCCATCTGCAAGTGCCTTGG - Intronic
1069847207 10:71380554-71380576 AAGTCCCTCATCAATTGTGATGG - Intergenic
1070197927 10:74176337-74176359 AAATCCATCTGCAAAGGTGGGGG - Intronic
1070893747 10:79964138-79964160 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
1071971478 10:90912068-90912090 AAGTCCTTCTATAAGTGTGGTGG - Intergenic
1072011049 10:91303327-91303349 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1072884768 10:99263333-99263355 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1073014347 10:100386027-100386049 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1073130628 10:101186810-101186832 TAGTCCTTTTGCAAGAGTGAAGG + Intergenic
1073395016 10:103210395-103210417 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1073683792 10:105731345-105731367 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1076028215 10:127134792-127134814 GAGTCCATGTGCAAGGGAGAGGG - Intronic
1076069974 10:127481620-127481642 ACCTCCAGCTCCAAGTGTGAGGG - Intergenic
1078354775 11:10625477-10625499 AAGTCCATCTGCAAGTGTGAAGG - Intronic
1079230835 11:18647379-18647401 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1079847363 11:25488598-25488620 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1080267174 11:30413685-30413707 AAGTCTACCTGCAAATGTGCAGG + Intronic
1080994224 11:37580620-37580642 TAGTCCCTTTGCATGTGTGAAGG + Intergenic
1081112858 11:39158334-39158356 AAGTCCATCAGTAAGTGAGAGGG - Intergenic
1081160049 11:39738902-39738924 TAGTCCCTTTGCAAGGGTGAGGG - Intergenic
1081589449 11:44410969-44410991 AAGTCCATCCATAAATGTGAGGG + Intergenic
1082087009 11:48058552-48058574 CAGTCCATCTGCCAGTCTGTGGG + Intronic
1086134518 11:83433001-83433023 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1086135964 11:83444290-83444312 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1086550523 11:88047515-88047537 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1086575266 11:88332529-88332551 AAATCCAATTGCAAGAGTGATGG - Intronic
1087197198 11:95313637-95313659 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1088760683 11:112926272-112926294 AAGTTTATCTGAAAGTGTTATGG - Intergenic
1089953653 11:122551454-122551476 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1090216096 11:124966530-124966552 ATGTGCCTCTGCACGTGTGATGG + Intronic
1090788028 11:130067753-130067775 AGGTTCATCTGCAAGTATGTGGG - Intergenic
1091330609 11:134728505-134728527 GGGGCCATCTGGAAGTGTGAGGG + Intergenic
1093707189 12:22287579-22287601 CAGTACATCTGCAACTGTAATGG - Intronic
1094826069 12:34270060-34270082 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1095637918 12:44453911-44453933 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1095806445 12:46325318-46325340 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1097541877 12:60953357-60953379 CAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1098481500 12:70967200-70967222 AAGTCCATCTGCAAATGTTCAGG + Intergenic
1098920230 12:76295951-76295973 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1098953514 12:76665673-76665695 AAGTCTATTTGCAAGAGTAAAGG - Intergenic
1102116461 12:110406881-110406903 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1103516507 12:121511890-121511912 CAGTCCATCTGCCAATGAGAAGG - Intronic
1104257932 12:127156071-127156093 CAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1104593005 12:130099641-130099663 ACCTCCAGCTGCAAGTGAGATGG - Intergenic
1105032611 12:132894517-132894539 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
1105286958 13:19012318-19012340 AATGCCCTCTGCAAGGGTGAGGG + Intergenic
1106274847 13:28194187-28194209 AAGTACATCTGAATTTGTGAAGG + Intronic
1106418941 13:29569503-29569525 CAGGCCCACTGCAAGTGTGAGGG + Intronic
1106982830 13:35309995-35310017 ATGTCCAACTGAAAATGTGAGGG + Intronic
1108702991 13:52959523-52959545 ATGTCCCTTTGCAAGAGTGAGGG + Intergenic
1109562328 13:64068270-64068292 GAGTCCATCTGCAATAGTCATGG + Intergenic
1110845629 13:80187806-80187828 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1110978761 13:81870306-81870328 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1111161468 13:84399773-84399795 GAGTGCAGCTGCAAGTGTGGGGG + Intergenic
1118798724 14:69169042-69169064 AAGTGCATCTGCATGTGTGTTGG + Intergenic
1120539283 14:85734556-85734578 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1120613555 14:86673776-86673798 AAGTCCATCTGCTGGTCTAAAGG - Intergenic
1120903053 14:89592524-89592546 AAGTCCATCTACCATTTTGATGG - Intronic
1121980318 14:98448858-98448880 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1123205940 14:106713486-106713508 AAGTCCATCTGCTTGTTTGTGGG - Intergenic
1123211024 14:106760891-106760913 AAGTCCATCTGCTTGTTTGTGGG - Intergenic
1123457785 15:20441565-20441587 GAGTGCACCTGAAAGTGTGAGGG - Intergenic
1123660284 15:22558850-22558872 GAGTGCACCTGAAAGTGTGAGGG + Intergenic
1123882260 15:24687465-24687487 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1124263932 15:28216717-28216739 GAGTGCACCTGAAAGTGTGAGGG - Intronic
1124314142 15:28653341-28653363 GAGTGCACCTGAAAGTGTGAGGG + Intergenic
1125157156 15:36600876-36600898 AAGTCTATCTACAAATGTTAAGG - Intronic
1125849367 15:42888602-42888624 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1126522379 15:49610690-49610712 CCATGCATCTGCAAGTGTGAAGG - Intronic
1126844084 15:52743079-52743101 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1130079852 15:80723347-80723369 AAGTTCACCTGCAACTGTGCAGG - Intronic
1131264766 15:90909491-90909513 ACCTCCATGTGCAGGTGTGAGGG + Exonic
1133939038 16:10293135-10293157 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1134330386 16:13245334-13245356 AAATCCCTCTGCAGGTGTGTGGG + Intergenic
1135070799 16:19349869-19349891 ATGTCCATCTGCTAGAGTTATGG - Intergenic
1137055024 16:35741231-35741253 AAGTCCTTTTGCAAGAGTGGGGG + Intergenic
1137363753 16:47842896-47842918 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1137896361 16:52217000-52217022 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1138054924 16:53822791-53822813 AAGGCCATCTGGAAGAGTGGTGG - Intronic
1138758810 16:59519223-59519245 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1142112906 16:88341639-88341661 CAGTCCACCTGCAGGTGTGCAGG - Intergenic
1143414027 17:6733008-6733030 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1144086913 17:11818127-11818149 AAGTCCATAAGAAAGTGGGATGG + Intronic
1145080392 17:19890202-19890224 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1151104534 17:71597117-71597139 CAGTCAATCAGCAAGTGTGGGGG + Intergenic
1151503056 17:74504694-74504716 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1151803264 17:76390249-76390271 AACTCCATGTGCATGTGTGAAGG + Exonic
1152454277 17:80404083-80404105 TACTCCTTCTGCAAGAGTGAGGG - Intergenic
1154155387 18:11940376-11940398 AATTCCATCTCCCAGTGTTATGG - Intergenic
1155033406 18:22003556-22003578 AGTTCCATCTCCAAGTGAGATGG + Intergenic
1155941831 18:31807927-31807949 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1155962277 18:32004576-32004598 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1156302571 18:35848253-35848275 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1157215951 18:45783604-45783626 AAGTCCATCTGAAAGAATCAGGG - Intergenic
1157340248 18:46771762-46771784 AGGTCCATCTGCTGCTGTGAAGG - Intergenic
1159632234 18:70762388-70762410 AAGGTCATCTGTAAGTGTGGGGG + Intergenic
1159929447 18:74296105-74296127 CAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1160348110 18:78151563-78151585 AAGTCCATGTGCAGATCTGAGGG + Intergenic
1162258248 19:9510584-9510606 AAGTTCTTCTGAAAGTGTTATGG - Intergenic
1162595073 19:11622135-11622157 AAGTTTATCTGAAAGTGTTATGG - Intergenic
1162622646 19:11856101-11856123 AAGTTTATCTGAAAGTGTTATGG - Intronic
1163235064 19:16025177-16025199 AAGCCCTTCTGCAAGGGAGACGG + Intergenic
1163899871 19:20091828-20091850 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1164153259 19:22572366-22572388 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1164220341 19:23187594-23187616 CAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165249470 19:34517652-34517674 AAGTCTCTTTGCAAGAGTGAGGG - Intergenic
1165961189 19:39535781-39535803 AAGTCTGTCTGCATGTGTGCAGG + Intergenic
1166320671 19:42016728-42016750 AAGTCCAGCAGCAGGTGAGATGG + Intronic
1166676578 19:44745088-44745110 AATTCCATCTGGAAGTCTGTAGG - Intergenic
1166905443 19:46105271-46105293 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1167808378 19:51806380-51806402 AAGTTTATCTGAAAGTGTTATGG - Intronic
1167826563 19:51978869-51978891 AAGTTTATCTGAAAGTGTTATGG + Intronic
1167901454 19:52625226-52625248 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1168248538 19:55127145-55127167 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1168485261 19:56756193-56756215 ATGTCCAGCTGCATGAGTGAAGG + Intergenic
925433554 2:3817403-3817425 CAGTCCCTTTGCAAGAGTGAGGG + Intronic
925818454 2:7776247-7776269 AAGTACATCTTGGAGTGTGAGGG + Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
926951209 2:18245613-18245635 AACTCCACCTCCAAGAGTGAAGG + Intronic
927596172 2:24400082-24400104 AACACCAGCTGCAAGTTTGAAGG + Intergenic
929383886 2:41382438-41382460 TAGTCCATTTGCAAGAGTGAGGG - Intergenic
930098716 2:47586855-47586877 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
930706410 2:54508998-54509020 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
931757853 2:65389969-65389991 AAAACAATGTGCAAGTGTGAGGG + Intronic
933179502 2:79213428-79213450 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
933438759 2:82282775-82282797 AAGTCCAACTGCTTGTGTTAGGG + Intergenic
936794013 2:116185847-116185869 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
938380361 2:130832935-130832957 CAGTCAGTCTGCAAGTGTGGTGG + Intergenic
938831090 2:135051015-135051037 AAGTCCAACTGGAAGTGCTAGGG - Intergenic
940110763 2:150150353-150150375 AAGTCCATCTGCAGGGATGTGGG + Intergenic
941455856 2:165711706-165711728 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
941750900 2:169134671-169134693 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
942768206 2:179482692-179482714 AAGTCCATTTGTAACTCTGAGGG + Intronic
943460909 2:188170788-188170810 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
944387732 2:199183499-199183521 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
945361918 2:208903355-208903377 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
945376387 2:209082198-209082220 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
945858461 2:215094089-215094111 CAGTCCTTCTGAAAGAGTGAGGG - Intronic
947229329 2:227869593-227869615 AAGTTCATCTGCATGTATGCAGG - Intergenic
947842509 2:233217217-233217239 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
1168850640 20:974400-974422 AAGGCGATCTGCAGGTGGGAGGG + Intronic
1169077243 20:2768717-2768739 AAGGCTATCATCAAGTGTGAAGG + Intergenic
1170034420 20:11975026-11975048 AGGTCCATCTGCAAGGAGGATGG - Intergenic
1171474391 20:25396738-25396760 AAGTTTATCTGAAAGTGTTATGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1174347090 20:49937984-49938006 AATTCATTCTGCAAGTGGGAGGG + Intronic
1175461784 20:59157318-59157340 AAGTCCTACTGAAAGTGTGGGGG + Intergenic
1180149157 21:45938927-45938949 ACGTCCACTTGCAAGCGTGAAGG - Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1183010829 22:34945183-34945205 AAGTCCAGGTGCAGGTGAGATGG + Intergenic
1183635318 22:39058666-39058688 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
1185094485 22:48798822-48798844 AAGTCCATGTGCAGGGTTGACGG + Intronic
949907300 3:8868883-8868905 AATTCCATCTGGATTTGTGAAGG - Intronic
951524926 3:23644450-23644472 AAGCCCATGTGGAAGTGGGAAGG + Intergenic
953656221 3:44856890-44856912 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
953865777 3:46582021-46582043 AAGTCCATCTGCGTGTGTGCAGG + Exonic
954161445 3:48725692-48725714 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
954276117 3:49542736-49542758 AATTCCTTCTGGAAGTGGGATGG - Intergenic
956000659 3:64726659-64726681 AAATCCCTATGCAAATGTGAGGG + Intergenic
956233237 3:67040367-67040389 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
957134525 3:76268483-76268505 GTGGCCATCTGCAAGTGAGAAGG - Intronic
957675039 3:83355199-83355221 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
957744467 3:84321105-84321127 AAATCCATCTGCAAGGCAGAAGG + Intergenic
957904520 3:86539589-86539611 TAGTTCATTTGCAAGAGTGAGGG + Intergenic
958422280 3:93942252-93942274 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
958676514 3:97274561-97274583 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
958925567 3:100153522-100153544 AAGGCCATCTGCAAGTGAAGGGG - Intronic
960309423 3:116102644-116102666 CAGTCCAAGTCCAAGTGTGAAGG - Intronic
961379294 3:126486889-126486911 ATGTACATGTGTAAGTGTGATGG + Intronic
962886657 3:139633918-139633940 AAGTGCATCCGCAAGTTTCAGGG + Intronic
963111587 3:141693204-141693226 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
964299943 3:155276553-155276575 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
964886281 3:161486789-161486811 CAGTCCAGCTGCAAATGTGGAGG - Intergenic
965861674 3:173157338-173157360 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
966067144 3:175832014-175832036 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
966279618 3:178211864-178211886 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
970146222 4:13038765-13038787 AAGTCAATTTGCAAGTGACATGG - Intergenic
970256136 4:14172107-14172129 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
970533012 4:17001792-17001814 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
970853773 4:20631880-20631902 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
973751395 4:54023767-54023789 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
974173137 4:58292909-58292931 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
974904114 4:68035111-68035133 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
976223048 4:82773455-82773477 AAGTCCTTCTGCAAGTGGAGGGG + Intronic
976739617 4:88344968-88344990 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
976872625 4:89813373-89813395 AAGTTCATTTGAAAGTGGGATGG - Intronic
977225061 4:94385054-94385076 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
977782173 4:100993456-100993478 AAGTCCTTTTGCAAGAGTGAAGG + Intergenic
979485150 4:121262488-121262510 AAATCCACCTGGAAGTGAGAGGG + Intergenic
979737373 4:124104387-124104409 AGGTCCATCTGCAGATTTGACGG + Intergenic
980003087 4:127513057-127513079 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
980302381 4:131011341-131011363 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
980928251 4:139159932-139159954 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
982396448 4:154920438-154920460 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
982622206 4:157722824-157722846 AAGTCCATGTTCCAGTCTGAAGG - Intergenic
983883445 4:172957746-172957768 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
984322464 4:178211211-178211233 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
984437576 4:179724776-179724798 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
985078717 4:186243738-186243760 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
986033212 5:3912428-3912450 GTGTCCATCTGTATGTGTGAGGG - Intergenic
986871782 5:12056659-12056681 AAGTCCTTCTGAAGGTGTGTGGG + Intergenic
989660169 5:43789906-43789928 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
989688587 5:44115940-44115962 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
990310670 5:54534791-54534813 AAGTACATCTGCTAGTGTGCTGG + Intronic
990564856 5:57018734-57018756 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
991734595 5:69620189-69620211 CATTCCATCTGTAACTGTGAAGG + Intergenic
991780383 5:70126532-70126554 CATTCCATCTGTAACTGTGAAGG - Intergenic
991811029 5:70475330-70475352 CATTCCATCTGTAACTGTGAAGG + Intergenic
991859670 5:71001946-71001968 CATTCCATCTGTAACTGTGAAGG - Intronic
991872830 5:71126843-71126865 CATTCCATCTGTAACTGTGAAGG - Intergenic
992451724 5:76882056-76882078 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
994295423 5:98083194-98083216 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
994778673 5:104065783-104065805 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
996574750 5:124968496-124968518 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
996723152 5:126649210-126649232 CAGTCCTTTTGCAAGGGTGAGGG - Intergenic
1000438839 5:161244095-161244117 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1001353964 5:171002601-171002623 TAGTCCCTTTGCAAGAGTGAAGG + Intronic
1001597988 5:172910435-172910457 AAGAGCATCTGCAACAGTGAAGG + Intronic
1001756098 5:174171423-174171445 CTGTCCATCTGCATGTGTGTGGG + Intronic
1002690036 5:181044249-181044271 AACACCATCAGCAGGTGTGAAGG - Intronic
1003049919 6:2770540-2770562 AAATGCATCTTCAAGTGTGCAGG - Intronic
1003100089 6:3170362-3170384 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1003205323 6:4004304-4004326 ATGTCCATCTGCCAGTCTCATGG + Intergenic
1003473662 6:6461543-6461565 AGCTCCATCCGCAAGTCTGACGG - Intergenic
1003501912 6:6710200-6710222 AGGTCCATATGCAGTTGTGAAGG - Intergenic
1003972254 6:11310872-11310894 AAGTCAATCTGCAGATGTGGAGG - Intronic
1004187840 6:13436685-13436707 AAGTCGATTTGCAAAGGTGAAGG + Intronic
1007084418 6:39133333-39133355 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1007300646 6:40865481-40865503 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1009379405 6:63009297-63009319 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1010096028 6:72047172-72047194 AAATCAATCTGCAAGTTGGAGGG - Intronic
1010586413 6:77662137-77662159 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1010658273 6:78538546-78538568 AGATCCATCAGCAAGTGTAAGGG + Intergenic
1010829423 6:80511900-80511922 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1010841067 6:80649650-80649672 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1012675374 6:102106075-102106097 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1014115011 6:117660925-117660947 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1015801073 6:137062705-137062727 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1016751221 6:147632378-147632400 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1017270129 6:152494601-152494623 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1018077878 6:160232441-160232463 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1021172995 7:17418212-17418234 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1021430129 7:20549565-20549587 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1021660871 7:22916849-22916871 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1022447698 7:30483346-30483368 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1024397842 7:48889695-48889717 CAGTCCATCTGAAAATGAGACGG + Intergenic
1024488405 7:49947449-49947471 CAGTGCATCTGCAAGTCTGCAGG - Intronic
1025226590 7:57170344-57170366 AAGTCCATGGGCAATTTTGAGGG - Intergenic
1025229650 7:57193641-57193663 AAGTCCATGGGCAATTATGAGGG - Intergenic
1025730705 7:64104343-64104365 AAGTCCATGGGCAATTATGAGGG + Intronic
1027158657 7:75786427-75786449 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1028589559 7:92480991-92481013 TAGTCCCTTTGCAAGAGTGAAGG + Intergenic
1029369921 7:100142755-100142777 AAGTCCTTCAGCAACTGGGAAGG + Intergenic
1030163295 7:106529803-106529825 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1030445577 7:109644217-109644239 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1033084982 7:138332992-138333014 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1033464726 7:141580199-141580221 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1033545715 7:142398414-142398436 AAGACCCTGTGCAAGTGAGAAGG + Intergenic
1033625841 7:143108784-143108806 TAGTCCCTTTGCAAGAGTGAAGG - Intergenic
1033636279 7:143214232-143214254 AAATCCAAATGCAAGTGTGAAGG + Intergenic
1036549990 8:9807209-9807231 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1037045231 8:14292246-14292268 TAGTACATATACAAGTGTGATGG + Intronic
1037878521 8:22561328-22561350 CAGTCCAGCTGCAAGTCTGCAGG - Exonic
1038027935 8:23608917-23608939 AAGTCCAAGTCCAAGTCTGAAGG - Intergenic
1038069903 8:24002294-24002316 AAGTCCATTTGTCAGTGTGCAGG - Intergenic
1039606425 8:38884426-38884448 AAGTCCAACTACATGTCTGAGGG - Intergenic
1040648319 8:49423864-49423886 TAGTCCCTTTGCAAGAGTGAAGG - Intergenic
1041917214 8:63149700-63149722 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1041953219 8:63527862-63527884 AAGTACTTGTGCAAGTGTGTGGG - Intergenic
1042841076 8:73124461-73124483 ATCTGCATCTGAAAGTGTGATGG - Intergenic
1043400308 8:79877933-79877955 AATTTCATCTCCAAGTGGGAAGG - Intergenic
1043717635 8:83506803-83506825 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1045068816 8:98478543-98478565 AAGTCCCTCTGCAAATTTGAGGG - Intronic
1047097974 8:121644036-121644058 AAGTCAATCTAAAAGAGTGAAGG - Intergenic
1047744087 8:127830962-127830984 TAGTCTGTCTGCAAGTTTGAGGG - Intergenic
1050896312 9:10888597-10888619 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1052730863 9:32283630-32283652 ATGTTCATCTGCAAGTGTGATGG - Intergenic
1053059704 9:35021390-35021412 TAGTCCCTTTGCAAGGGTGAGGG + Intergenic
1053419984 9:37971212-37971234 ACATCCATCTGCATGTGTGTGGG - Intronic
1053589491 9:39497372-39497394 AAATCCACCTACATGTGTGAGGG + Intergenic
1054576806 9:66867913-66867935 AAATCCACCTACATGTGTGAGGG - Intronic
1055882007 9:81013136-81013158 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1056324170 9:85462773-85462795 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1058025914 9:100142276-100142298 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1061949476 9:133928263-133928285 AAGTTCATCTGAAAGTGGGTGGG + Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1187103489 X:16218567-16218589 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1191013915 X:55790076-55790098 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1191675752 X:63790733-63790755 AAGTCCTTCAGAAAGTGAGAGGG + Intergenic
1191761623 X:64653402-64653424 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1192454955 X:71268760-71268782 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1192544798 X:72004570-72004592 AAATCCATCTGGAAGTGTTTGGG + Intergenic
1192706439 X:73531802-73531824 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1194660999 X:96628367-96628389 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1194873482 X:99160828-99160850 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1195016779 X:100788855-100788877 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1195326588 X:103763454-103763476 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1195975570 X:110522469-110522491 AAGTCCATCTGCGTGTGTGCAGG + Intergenic
1196497102 X:116334652-116334674 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1197782823 X:130173968-130173990 AAGTCCATCTGAAATTTAGATGG + Intronic
1198966238 X:142230894-142230916 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1200358229 X:155574404-155574426 AAGTGGATCTGCATGTGGGATGG - Intronic
1200813150 Y:7505070-7505092 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1202074341 Y:21023246-21023268 AAGACCATCTGTAGCTGTGATGG + Intergenic
1202076209 Y:21040299-21040321 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic