ID: 1078355147

View in Genome Browser
Species Human (GRCh38)
Location 11:10627442-10627464
Sequence GCTGCTGGTTGGAGACAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078355147_1078355158 15 Left 1078355147 11:10627442-10627464 CCCCCTTGTCTCCAACCAGCAGC 0: 1
1: 0
2: 1
3: 24
4: 276
Right 1078355158 11:10627480-10627502 CGCTGTGAGTATTGCCTCCACGG 0: 1
1: 0
2: 0
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078355147 Original CRISPR GCTGCTGGTTGGAGACAAGG GGG (reversed) Intronic
900384601 1:2404489-2404511 GCTGATGGATGGAGCCACGGCGG + Exonic
900415611 1:2533143-2533165 GCTGCTGGGGGCAGCCAAGGTGG - Intergenic
900645721 1:3707829-3707851 GCTGCGGGCTGGAGAGGAGGTGG + Intronic
902802712 1:18840267-18840289 GCTGCTGGTGGCATACATGGTGG - Exonic
902814285 1:18907413-18907435 GCTGCTGGCAGGAGAGAAGCAGG - Exonic
903451335 1:23455644-23455666 GCTCCTGGGTGAAGAGAAGGAGG + Intronic
903473836 1:23605975-23605997 GCTGGTGTTGGGAGAAAAGGCGG - Intronic
903934052 1:26882611-26882633 GCAGCATGCTGGAGACAAGGGGG - Intronic
904090116 1:27939201-27939223 CCTTATGGTTGGAGACAGGGGGG - Intronic
905797261 1:40822766-40822788 GCAGCTGGTTGGAGAAAGTGTGG + Intronic
906448288 1:45922327-45922349 GCTCCTGGGTGGAGAGAAGCTGG - Intronic
907469771 1:54665775-54665797 GCTGCTTGATGGACACAATGTGG + Intronic
908490011 1:64634105-64634127 ACTGGTGGCTGGAGACAAGAAGG - Exonic
908599734 1:65725872-65725894 ACTTCAGGTTGGAGACAAGATGG + Intergenic
909706161 1:78587468-78587490 GTTGCTGGTTGGAATCAAGTTGG - Intergenic
909788054 1:79640810-79640832 GCTGCTGCATGGAGACATGAGGG + Intergenic
910860858 1:91741407-91741429 GCTGCTGGTTGGTGAGCATGTGG - Intronic
911925790 1:103830777-103830799 GCTGCTTGTGGGAGCCAGGGTGG - Intergenic
912199540 1:107440704-107440726 CCTCCTGGTTAGAGACAAGACGG + Intronic
912656209 1:111488474-111488496 GCTGGAAGTTGGGGACAAGGAGG - Intronic
914705042 1:150163297-150163319 GCTCCTGTTGGGAGACAGGGAGG - Intronic
917108266 1:171517593-171517615 GTTGCTTGTTGGAGAGATGGTGG + Exonic
919168722 1:193927642-193927664 GCTGCAGGTGGGAGCTAAGGGGG - Intergenic
919835327 1:201569276-201569298 GCTGCTGGTTGCCTACCAGGAGG - Intergenic
919976634 1:202617062-202617084 GCTGCTGGATGGAGAGCATGAGG - Intronic
920273945 1:204789963-204789985 GCTGCTGGTGGGTGGCAGGGAGG + Intergenic
920427097 1:205887176-205887198 GCTGCTGCATGGAGACATGATGG + Intergenic
920849498 1:209618940-209618962 GCTGCGGGCTGGGGAGAAGGAGG + Intronic
922041138 1:221899762-221899784 GCTGCTGCTTTGAGGCTAGGAGG + Intergenic
924500683 1:244635622-244635644 GCTGCTTCTGGGAGACACGGGGG - Intronic
1063123984 10:3124177-3124199 GCTACTGGTGGGACACAGGGCGG - Intronic
1063705918 10:8430691-8430713 GCTGCTGGGAGGAGACCTGGGGG + Intergenic
1064218257 10:13418217-13418239 GCTGCTGATTTGAGAGGAGGCGG - Intergenic
1064579344 10:16778356-16778378 ACTGCTGGCTGGAGAGAAAGTGG - Intronic
1065753730 10:28912089-28912111 GCTGGTGTTTGGGGCCAAGGAGG + Intergenic
1066174406 10:32888424-32888446 GCTGCTGGTTGGATGCCAGGCGG - Intergenic
1071872331 10:89808972-89808994 GCTGCTTCTGGGAGACAAAGTGG + Intergenic
1072065492 10:91866191-91866213 GCTGTGGGTGGGTGACAAGGTGG - Intergenic
1076611134 10:131726550-131726572 GCTGCTGTTTCGAGCGAAGGCGG - Intergenic
1076629451 10:131843415-131843437 GCAGCTGGTTGGAAGAAAGGCGG - Intergenic
1077325267 11:1961033-1961055 GCTGATGGTTGCAGGAAAGGTGG - Intronic
1077350871 11:2092671-2092693 GCTGCTGGAAGGAGACAGTGGGG - Intergenic
1078355147 11:10627442-10627464 GCTGCTGGTTGGAGACAAGGGGG - Intronic
1078559064 11:12354984-12355006 GCTGCTGGTGGGAGGCAGGCTGG - Intronic
1079139276 11:17796963-17796985 GGTGAGGGTTGGAGGCAAGGAGG + Intronic
1080443775 11:32318546-32318568 GGTGCTGGTGGGAGGCAAAGAGG - Intergenic
1081383433 11:42443772-42443794 GCTGCTGGTTGGAAACCAGTGGG - Intergenic
1082261481 11:50078837-50078859 GCTGCTGATCTGAGAGAAGGTGG + Intergenic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1083397261 11:62400420-62400442 GCTGCTGGCTGGTGACCATGAGG - Intergenic
1083466703 11:62851708-62851730 GCTGCTGGTTAAAGTCAAGTAGG + Intergenic
1083822067 11:65178190-65178212 TCTTCTGGTGGGAGATAAGGAGG - Intronic
1084196756 11:67527159-67527181 GCTGCTGATTGAACACAAGCAGG - Intergenic
1084323443 11:68385971-68385993 GGGGCTGGCAGGAGACAAGGGGG + Intronic
1084618450 11:70252020-70252042 GCTGCTGGCTTGAGACGACGCGG + Intergenic
1085254954 11:75167149-75167171 GCTGCAGCTTAGAGAGAAGGTGG + Intronic
1087482818 11:98722537-98722559 ACTGCTTCTTGGAGACAAGTCGG + Intergenic
1088089496 11:106021861-106021883 GCTGCTGGTAGGAGTCCCGGTGG + Exonic
1088113639 11:106291609-106291631 TCTGCTATTTGGAGACATGGTGG + Intergenic
1089973096 11:122710334-122710356 GCTGGTGGTTGGAGAGATGGTGG + Intronic
1091096635 11:132828917-132828939 GCTGCTGAGTGGAGAAAACGAGG - Intronic
1091130417 11:133142153-133142175 TCTGCTGGTAGAAGACATGGTGG - Intronic
1091215505 11:133898972-133898994 GCTGCTGGTTGGTGACAGTGGGG + Intergenic
1091216007 11:133902636-133902658 GCTGGGGGTTAGAGACCAGGGGG + Intergenic
1202808248 11_KI270721v1_random:16212-16234 GCTGATGGTTGCAGGAAAGGTGG - Intergenic
1091990184 12:4948661-4948683 GATGCCAGTTGGCGACAAGGGGG + Intergenic
1092412438 12:8264110-8264132 CCTGCTGGGTGCAGACATGGTGG + Intergenic
1093383361 12:18521592-18521614 CCTCCTGGCTGGAGCCAAGGAGG - Intronic
1094204812 12:27829218-27829240 GCTCCTGGCTGGAGCCAAAGGGG - Intergenic
1094774633 12:33710751-33710773 GGTGGTGGGTGGAGAGAAGGAGG + Intergenic
1095772101 12:45971511-45971533 GATTCTGGATGGAGAAAAGGTGG - Intronic
1096489872 12:52007504-52007526 GGTGCTGGGAGGAGTCAAGGAGG - Intronic
1097083842 12:56453238-56453260 GCTGCTGGCTGGAGAAAAGATGG - Intronic
1100089528 12:90953902-90953924 GCTGCTGGTGGAAGAAGAGGAGG - Exonic
1101444783 12:104729911-104729933 GCTGCTGGTTGGTGTCGGGGTGG + Intronic
1102037567 12:109780945-109780967 GCTGGTTGTTTGGGACAAGGAGG - Intergenic
1102493374 12:113302692-113302714 TCTGTGGGTTGGAGACGAGGAGG - Intronic
1106231245 13:27822901-27822923 GCTGCTGGTTTGTGAAAAGACGG - Intergenic
1108438054 13:50420772-50420794 ACTCCTGGATGGAGACCAGGTGG + Intronic
1108947683 13:56044149-56044171 GCTGCTGCATGGAGACATGATGG - Intergenic
1111020677 13:82445043-82445065 GCTGCTGATGTGAAACAAGGTGG - Intergenic
1112310813 13:98316201-98316223 ACAGCTGGTTCGAGCCAAGGCGG - Intronic
1112319815 13:98395861-98395883 GCTGCTGCTGGGAGACAATGGGG - Intronic
1113542818 13:111122213-111122235 GCTGCTGGTTGGGGAGCGGGAGG + Intronic
1113963555 13:114139220-114139242 GGTGGTGGGTGTAGACAAGGTGG + Intergenic
1113963587 13:114139361-114139383 GGTGGTGGGTGTAGACAAGGTGG + Intergenic
1115477893 14:33833976-33833998 GCTGCTCGATGGAGACCGGGTGG + Intergenic
1117667298 14:58070013-58070035 GATGCTGGCTGAAGGCAAGGAGG + Intronic
1118489124 14:66242266-66242288 GCTGCTGATTGGCACCAAGGAGG + Intergenic
1118760329 14:68877078-68877100 GATCCTGGCTGGGGACAAGGTGG - Exonic
1120666657 14:87314453-87314475 ACTGCTGGCTGGAGAAATGGAGG - Intergenic
1121015527 14:90546607-90546629 GCTGCTGGTTGGGGGCAGTGTGG - Intronic
1121507869 14:94490336-94490358 GCTGCTAGTTGGAGGGCAGGAGG - Intronic
1121979727 14:98444122-98444144 CATGCAGGTTGGAGGCAAGGAGG - Intergenic
1122345274 14:101054740-101054762 GCTGAGGGTTGGTGACTAGGTGG - Intergenic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1124241039 15:28027784-28027806 GCTGCTGGTTTGAAAGATGGAGG + Intronic
1124492286 15:30165435-30165457 GCTGCTGGATGGAGAGCATGAGG - Intergenic
1124751249 15:32372882-32372904 GCTGCTGGATGGAGAGCATGAGG + Intergenic
1124827792 15:33115881-33115903 TTTGCTGGTTGGAGTAAAGGTGG - Intronic
1125978151 15:43974071-43974093 TCTACTGGGTGGAGACAAAGAGG + Intronic
1127279383 15:57475908-57475930 GCTGCTGGGTGGACCCAAGAAGG - Intronic
1128213160 15:65916309-65916331 GCTGCTGGGTGGGGACAAGGGGG + Intronic
1128757109 15:70190558-70190580 GCTGCTGTTTGGAGCCATCGAGG - Intergenic
1130872887 15:87985243-87985265 GCTACTGCTGGGAGAGAAGGTGG + Intronic
1131074081 15:89483991-89484013 GCTGCTGGCAGGGGACAAGGAGG - Intronic
1131880895 15:96860721-96860743 TCTGGTGGTTGGAAACAAGTTGG + Intergenic
1132345448 15:101105504-101105526 GCTGCAGACTGCAGACAAGGGGG + Intergenic
1133224999 16:4336903-4336925 GCTGCTCGTGGGACACAAAGTGG - Exonic
1134229831 16:12420113-12420135 GCTGCTGGGTAGAGGCCAGGAGG - Intronic
1134610775 16:15606335-15606357 GCAGGTGGTTGGATTCAAGGTGG - Intronic
1134677434 16:16100348-16100370 GCTGCTGGTAGGAGAGCGGGGGG + Intronic
1135463205 16:22662915-22662937 GCTTTTGGGTGGAGAGAAGGAGG - Intergenic
1138647317 16:58434734-58434756 GGTGCTGGTTGGGGGAAAGGTGG - Intergenic
1139221132 16:65183373-65183395 GCTGCTGTTTGGTGACTAGAAGG + Intergenic
1140319419 16:73934235-73934257 GCTATTGGTTTGAGACAATGGGG - Intergenic
1140507362 16:75482215-75482237 GCTGGTGGTTGGAGGCCAGAGGG - Intronic
1140900965 16:79367317-79367339 GCTGCTGGTTGAAGTCACAGGGG + Intergenic
1141251155 16:82360212-82360234 GCTGCTGACTGAGGACAAGGGGG + Intergenic
1141265797 16:82495815-82495837 GCTGCTGTATGGAGAAAGGGTGG + Intergenic
1141606773 16:85158537-85158559 GCTGCTGGGTGGAGAACAGACGG + Intergenic
1141699311 16:85635188-85635210 GCTGCTCGTTGGAGAATGGGGGG + Intronic
1141712606 16:85708695-85708717 GGTGCTGGGTGGAGCCATGGTGG - Intronic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1143448086 17:7020341-7020363 GGTGCTGGTGGGGTACAAGGAGG - Intergenic
1143699579 17:8648217-8648239 GCTGCAGGCTGGAGACACAGAGG + Intergenic
1144728991 17:17515980-17516002 ACTGCTGGCTGGGGACAGGGCGG - Intronic
1145904408 17:28508292-28508314 GCTGTTGGTTGGAGGCAATGTGG - Intronic
1147447583 17:40484213-40484235 TCTGATGGTGGGAGAGAAGGAGG - Intronic
1147995025 17:44355551-44355573 GCTGGTGGTTGAAGACAGCGGGG - Intronic
1148145878 17:45364599-45364621 GCTGCGGGGTGGAGACAGAGGGG - Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150788702 17:68183078-68183100 GCTGCTGGTGTGAGCCAAGGGGG - Intergenic
1152587160 17:81194241-81194263 GCTTCGGGTTGGATCCAAGGAGG - Intronic
1154078015 18:11224277-11224299 GCAGCTGGCTGTAGACATGGTGG - Intergenic
1154981752 18:21508261-21508283 GCCCCTGGTTTCAGACAAGGTGG + Exonic
1158263113 18:55631388-55631410 GCTGCAGGGTGGAGAAAAGATGG + Exonic
1158453717 18:57588471-57588493 CCTGCTGGGTAGAGATAAGGGGG + Intergenic
1158666150 18:59434426-59434448 GCTGCTCATTGGAAACAAGAGGG + Exonic
1160816875 19:1040150-1040172 GCTGCTGGGCGGAGGGAAGGCGG + Exonic
1162133206 19:8539979-8540001 GAAGCTGGATGGAGACAAGAAGG - Exonic
1162685129 19:12376577-12376599 GCCACTGGGTGGTGACAAGGTGG + Intergenic
1163839240 19:19595744-19595766 GCTGGGGGGTGGGGACAAGGAGG + Intronic
1165151988 19:33766397-33766419 GGTGCTGGCAGGAGAGAAGGTGG - Intronic
1166096492 19:40542494-40542516 GCTCCTGCTTGGAGAGATGGGGG + Intronic
1167832581 19:52038183-52038205 GCTGCTTGTTGGAGAAATCGTGG - Intronic
1202652607 1_KI270707v1_random:20569-20591 GCTGTTGGTGGGAGGCAAGAGGG - Intergenic
925103228 2:1267236-1267258 TCTCCTGGGTGCAGACAAGGAGG - Intronic
929491498 2:42400541-42400563 GCTTCAGGTGGGTGACAAGGAGG - Intronic
932794050 2:74679969-74679991 ACTTCTGGCTAGAGACAAGGTGG + Exonic
933656846 2:84895493-84895515 GCTGCTGGTAGTAGGAAAGGAGG + Intronic
935125961 2:100223159-100223181 GAGGATGGTTGGAGGCAAGGAGG - Intergenic
936584226 2:113739392-113739414 GCAGTTGGTTGGATCCAAGGAGG + Intronic
937104412 2:119296561-119296583 GCTGATTGCTGGGGACAAGGGGG - Intergenic
937146868 2:119654986-119655008 GCTTCTGGCTGGAGAGAAGGAGG - Intronic
938711311 2:133978252-133978274 GCTGTTGGTGGGACACAAGGAGG + Intergenic
938849418 2:135245406-135245428 CCTGCTGGATGGAAACAAAGAGG + Intronic
939820061 2:146946639-146946661 GCTGGAGGGTGGAGAGAAGGAGG + Intergenic
941917203 2:170820625-170820647 CCTAGTGGTTGGGGACAAGGAGG - Intronic
942156350 2:173132541-173132563 TCTCCTGGGTGGAGGCAAGGAGG - Intronic
943114708 2:183653775-183653797 GTGGCTGCTTGGGGACAAGGAGG - Intergenic
945124119 2:206489279-206489301 GCTGCTAGTTGGAGAGAAAAAGG - Intronic
946409790 2:219510263-219510285 GCTGCTGGGAGCAGATAAGGCGG - Intergenic
947826263 2:233107804-233107826 GCGGGTGGTTGGAGACAGGGTGG + Intronic
948158221 2:235801678-235801700 GCAGCTGGATTGAGAGAAGGTGG + Intronic
948306782 2:236954326-236954348 GCTGCTGAATTGACACAAGGAGG + Intergenic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
1169496805 20:6123170-6123192 GCTGCTCGGCGGAGAGAAGGCGG + Exonic
1170809474 20:19662403-19662425 GCTGCTGTCTTGAGGCAAGGTGG - Intronic
1171393746 20:24817671-24817693 GCTGCTGGTTGGAGTCACCTGGG - Intergenic
1172045511 20:32077329-32077351 GTGGCTGGTTGGGGACAGGGTGG - Intronic
1172175817 20:32971155-32971177 GATGGGGGTGGGAGACAAGGTGG + Intergenic
1172220273 20:33269245-33269267 GCTCATTATTGGAGACAAGGGGG + Intergenic
1174693435 20:52532609-52532631 GCTGGTGGTTGGAGGCAAAAGGG + Intergenic
1175407709 20:58745567-58745589 GCAGCTGGTTTGAGACTATGGGG + Intergenic
1176028653 20:62999517-62999539 GCTGCTGGTGGAAGAAACGGAGG - Intergenic
1176376538 21:6089496-6089518 GGTGCTAGGTGGAGACAACGTGG + Intergenic
1176599544 21:8779085-8779107 GCTGTTGGTGGGAGGCAAGAAGG + Intergenic
1178833843 21:36079333-36079355 ACTGCTGCTCTGAGACAAGGTGG - Intronic
1179202227 21:39235674-39235696 GCTCTGGGTTGGATACAAGGAGG + Intronic
1179492835 21:41752465-41752487 GCTCCTGGCTGCAGAGAAGGAGG - Intronic
1179746937 21:43448748-43448770 GGTGCTAGGTGGAGACAACGTGG - Intergenic
1180418891 22:12795821-12795843 GCTGTTGGTGGGAGGCAAGAGGG - Intergenic
1181237621 22:21457171-21457193 GCTGCTGGAGGAAGACAAGGTGG + Intergenic
1181395043 22:22615229-22615251 GCTGCTGATTGAGGACATGGTGG + Intergenic
1181674302 22:24441790-24441812 GCTGCTCTGTGGAGACAAGGTGG - Exonic
1182444694 22:30383253-30383275 GCTGCAGGCTGGGGTCAAGGTGG - Intronic
1182945672 22:34319463-34319485 GCTGCTGGGTGGAGAAAGGATGG + Intergenic
1183034483 22:35130919-35130941 GCTGTTTGTTGGAGACAATGGGG + Intergenic
1184284819 22:43464609-43464631 GCTGCTGGATGGGTGCAAGGTGG + Intronic
949224685 3:1680573-1680595 GCTGTTGGTTGGCGGGAAGGAGG - Intergenic
949897902 3:8783830-8783852 GCTGCTGTGTGGAGAGAAGGAGG - Intronic
951098237 3:18656405-18656427 GCTGAGGGGTGGAGACATGGTGG + Intergenic
952330916 3:32363880-32363902 CTAGCTGGTTGTAGACAAGGTGG + Intronic
952819187 3:37471251-37471273 CATGCTTGTTGGAGAGAAGGAGG - Intronic
958487404 3:94730240-94730262 GCTTCTGGTTGCACAAAAGGTGG - Intergenic
958736377 3:98014228-98014250 GCTGCTGGTTAGAAACAATAAGG + Intronic
959815779 3:110671722-110671744 TCTGCTGGTTGCAAACACGGTGG - Intergenic
960124808 3:113986816-113986838 GCTTCTGTTTGGAGACAGAGGGG - Intronic
961331883 3:126147357-126147379 GCAGCAGGCTGGAGACAGGGTGG + Intronic
964068109 3:152601079-152601101 GCTGCTGCATGGAGACATGATGG - Intergenic
964373999 3:156031662-156031684 TCTGGTGGTTGGTGAGAAGGTGG + Intergenic
967098776 3:186198714-186198736 ACTGCTGGCTGGAGGCAACGGGG + Intronic
967126872 3:186432037-186432059 GCAGCAGGTTGGAGAGAAGGAGG + Intergenic
968178591 3:196572575-196572597 GATGCTGGTTTGAGATAAGATGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968983024 4:3860959-3860981 GCTCCGGGTTGGACACAGGGAGG - Intergenic
970716646 4:18934400-18934422 ACTGCTGGATAGACACAAGGGGG - Intergenic
972426521 4:38938170-38938192 GCTGCTGAGTGAAGCCAAGGTGG - Intronic
973362896 4:49181456-49181478 GCTGTTGGTGGGAGGCAAGAGGG + Intergenic
973398203 4:49615398-49615420 GCTGTTGGTGGGAGGCAAGAGGG - Intergenic
973771195 4:54208648-54208670 GGTGCTTTTTGGAGACATGGAGG + Intronic
974904049 4:68034615-68034637 GCTGCTGCATGGAGACATGATGG - Intergenic
976449238 4:85167384-85167406 GCTTCTTGTTGAAGACAAGGAGG + Intergenic
977151718 4:93520903-93520925 GATGCTGTGTGGAGACCAGGGGG + Intronic
980291366 4:130850464-130850486 TCTGCTGGTTAGAAACCAGGAGG - Intergenic
981669941 4:147275266-147275288 TCTAGTGTTTGGAGACAAGGGGG + Intergenic
982865286 4:160502414-160502436 GTTGCTGGTTGGAGCAACGGTGG + Intergenic
983992035 4:174131000-174131022 GCTGCTGCTTGGGGAACAGGAGG + Intergenic
985657562 5:1140088-1140110 GGTGCTGGTTGAGGCCAAGGCGG - Intergenic
985983594 5:3491890-3491912 TCTTCTGGTAGGAGACAAAGGGG - Intergenic
988979887 5:36556734-36556756 GCTGTTGGGTGGAGACTATGGGG - Intergenic
989192961 5:38689247-38689269 GTTGGTGGTTGAAGCCAAGGGGG - Intergenic
990736959 5:58875125-58875147 GCTGCTGGTTGGGGGTCAGGGGG - Intergenic
990756221 5:59073515-59073537 GCGGGTGGTTGGAGATGAGGAGG + Intronic
992961081 5:81957125-81957147 GCCGCTGCTCGGAGACATGGTGG - Intergenic
993899381 5:93574006-93574028 GCTGCTGGTTGGAGTTTAGTTGG - Intergenic
997417009 5:133736755-133736777 GCTGCAGGTTGGACACCAGCAGG - Intergenic
997819620 5:137053199-137053221 GCTGCTGCTCAGGGACAAGGAGG + Intronic
998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG + Intergenic
998484025 5:142486175-142486197 GCTGCTGGTTTTAGCCAAAGTGG + Intergenic
1000298004 5:159928842-159928864 GCAGCTGGTTGGGGAGGAGGAGG + Intronic
1000336545 5:160245689-160245711 GATGCTGGTTGCTGGCAAGGAGG + Intergenic
1001481028 5:172089359-172089381 CCACCAGGTTGGAGACAAGGTGG - Intronic
1002054456 5:176590703-176590725 GGTGAAGGTTGGAGACACGGGGG - Intronic
1002567171 5:180118701-180118723 GGTGCTGGAAGGAGACAGGGAGG + Exonic
1002640800 5:180629767-180629789 GCTGCTGGTAGGGGAGAAGCTGG - Exonic
1004264172 6:14134471-14134493 CCTGGTGGATGGAGACAAAGGGG - Intronic
1005440994 6:25868522-25868544 CCATCTGGTTGGAGACAGGGAGG + Intronic
1005902965 6:30235129-30235151 GCTGCTTTATGGAGACAAGGTGG - Intergenic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1007410165 6:41656867-41656889 CCTGCTTGTGGGAGAGAAGGTGG + Intergenic
1007718801 6:43873045-43873067 GATGCTGGGTGGGGACACGGTGG + Intergenic
1013026512 6:106278748-106278770 GCTTATTGCTGGAGACAAGGAGG + Intronic
1014054606 6:116999379-116999401 TCTGCAGATTGGTGACAAGGCGG - Intergenic
1014303320 6:119710883-119710905 GCTACAGGTTAGGGACAAGGAGG - Intergenic
1015591857 6:134829934-134829956 ACTGCTGGCTGGAGATGAGGAGG - Intergenic
1017077325 6:150631304-150631326 GGTGCTGGATGGAAAAAAGGTGG - Intronic
1018473962 6:164122254-164122276 GCTGCTGGAGGGAGCCCAGGGGG + Intergenic
1019433554 7:1010630-1010652 GCTGCAGGCTGGGGACAGGGAGG + Intronic
1019661638 7:2227474-2227496 GCTGCTGGCTGGCGTCCAGGGGG + Intronic
1019706986 7:2501657-2501679 GCTGCTGGAAGGAGGGAAGGTGG - Intergenic
1020287864 7:6699441-6699463 GCTGCTGATGGGACACACGGTGG + Intronic
1021595866 7:22316177-22316199 GGTGCTGGTTATAGAGAAGGAGG - Intronic
1022883610 7:34618318-34618340 GCTGGGGGCTGGAGAAAAGGGGG + Intergenic
1023477143 7:40593057-40593079 GCGGCTGGTAGGACACAAAGGGG + Intronic
1023862827 7:44226139-44226161 GCTGCTGGCTTGGGTCAAGGTGG - Intronic
1024399949 7:48912918-48912940 GCTTCTGGTTGGAGATTTGGTGG + Intergenic
1025858837 7:65307696-65307718 GCTACTGCTTTGAGACAAGGGGG - Intergenic
1025912154 7:65837889-65837911 GCTGCTGATCTGAGAGAAGGCGG - Intergenic
1026359574 7:69591320-69591342 GCTGATAGCTGGAGACAATGGGG - Intergenic
1026770725 7:73196542-73196564 GCTGCTGGTAGAAGGGAAGGAGG + Intergenic
1026922983 7:74170027-74170049 GCTGCTGGCTGGGGAGAAAGGGG + Intergenic
1027011592 7:74749933-74749955 GCTGCTGGTAGAAGGGAAGGAGG + Intronic
1027076448 7:75196111-75196133 GCTGCTGGTAGAAGGGAAGGAGG - Intergenic
1027526376 7:79274360-79274382 GCTGCTGGTTAGAGACTAGAGGG + Intronic
1028889334 7:95969472-95969494 TTTGATGTTTGGAGACAAGGAGG - Intronic
1030462165 7:109853227-109853249 GCTGCTGTTTGGAGAAGAGGTGG - Intergenic
1033295381 7:140129050-140129072 GCTGCTGCTTAGAGGAAAGGTGG - Intronic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1038004187 8:23416217-23416239 GCTGCATCTTTGAGACAAGGTGG - Intronic
1038016641 8:23521486-23521508 GCTGCAGGTTGGTAAAAAGGAGG + Intergenic
1038760119 8:30378252-30378274 ATTGCTGGCTGGAGAAAAGGGGG - Intergenic
1043419279 8:80082679-80082701 GCTGCTGCTGGGAGAAGAGGGGG - Intronic
1045523951 8:102927727-102927749 GCTGATGCTTGGAGGCAAGAAGG + Intronic
1045828704 8:106432226-106432248 GCTGCTGGGTGAAGAAAAGATGG - Intronic
1049576185 8:143390981-143391003 GTTGCTGCGTGGAGACAGGGTGG + Intergenic
1049762730 8:144338325-144338347 GCTGCCGCTCGGAGATAAGGGGG - Intergenic
1050355267 9:4776858-4776880 ACTGCTGGTGAGAGACAAGAAGG - Intergenic
1050626618 9:7510990-7511012 GGTTCTGGTGGGAGATAAGGTGG + Intergenic
1051953197 9:22660650-22660672 GCTGCTGCACGGAGACAAGATGG + Intergenic
1052394834 9:27926508-27926530 GATGCTGGATAGAGAAAAGGAGG - Intergenic
1053837424 9:42155166-42155188 GCTGCAGGTTTTAGACAATGTGG + Intergenic
1054806197 9:69397799-69397821 TCTGCTTGGTGGAGACAAGCAGG + Intergenic
1055931733 9:81566139-81566161 GCTGCTGCCTGGAGAAAGGGAGG + Intergenic
1056394295 9:86167612-86167634 GCTGCAGGTAGTGGACAAGGTGG + Intergenic
1056553123 9:87667317-87667339 GCTGCCGGTTGAAGCCCAGGTGG - Intronic
1057032200 9:91784343-91784365 GCTGCTGCATGGAGAGCAGGTGG - Intronic
1057231705 9:93325289-93325311 GATGCTGAGTGGAGACCAGGAGG + Intronic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1060183912 9:121552365-121552387 GCTGGTGGCTGGAGAGATGGTGG - Intergenic
1061755327 9:132808512-132808534 GCTGCTGATTCGAAAGAAGGAGG + Intronic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1062295852 9:135826130-135826152 GCTGCTGGGTGCAGACAACAGGG + Intronic
1062547127 9:137068941-137068963 GCTGGTGTTTGGAGCCACGGCGG - Intronic
1192269861 X:69568838-69568860 GCTGCTGGTTGGAAATGGGGAGG + Intergenic
1196300242 X:114043822-114043844 GCTGCTGCATGGAGACATGATGG - Intergenic
1196656104 X:118218949-118218971 GCTGCAGGGTGGGGACAAAGGGG - Intergenic
1196992427 X:121344868-121344890 GCCGCTGCATGGAGACATGGTGG + Intergenic
1197087982 X:122501803-122501825 GCAGCTGCCTGGAGAGAAGGTGG + Intergenic
1198764533 X:140067281-140067303 GCAGCTGGTTAGAGAGAACGAGG - Intergenic
1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG + Intergenic