ID: 1078355334

View in Genome Browser
Species Human (GRCh38)
Location 11:10628301-10628323
Sequence GTGCCCTGCCGCACTGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078355329_1078355334 -10 Left 1078355329 11:10628288-10628310 CCCCGACCTGAGCGTGCCCTGCC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1078355334 11:10628301-10628323 GTGCCCTGCCGCACTGATGAGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1078355327_1078355334 3 Left 1078355327 11:10628275-10628297 CCAGGCTGCCTGGCCCCGACCTG 0: 1
1: 0
2: 6
3: 45
4: 441
Right 1078355334 11:10628301-10628323 GTGCCCTGCCGCACTGATGAGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1078355328_1078355334 -5 Left 1078355328 11:10628283-10628305 CCTGGCCCCGACCTGAGCGTGCC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1078355334 11:10628301-10628323 GTGCCCTGCCGCACTGATGAGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1078355326_1078355334 4 Left 1078355326 11:10628274-10628296 CCCAGGCTGCCTGGCCCCGACCT 0: 1
1: 0
2: 4
3: 27
4: 304
Right 1078355334 11:10628301-10628323 GTGCCCTGCCGCACTGATGAGGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078355334 Original CRISPR GTGCCCTGCCGCACTGATGA GGG Intronic
902212764 1:14915560-14915582 CTGCCCAGCAGCACTGCTGAGGG + Intronic
902675434 1:18005416-18005438 CTTCCCTGCCCCACTGATGTTGG + Intergenic
909604290 1:77493195-77493217 GTGCCCACCCACACTGGTGAGGG - Intronic
909979479 1:82081629-82081651 ATGCCCTCTCGCACTGGTGAGGG + Intergenic
912083147 1:105963646-105963668 GTGCCCTTCCTCACTGATTCTGG + Intergenic
915040157 1:152961569-152961591 TTTCCCTGCCGCATTGCTGATGG - Intergenic
919888472 1:201952541-201952563 ATGCCCAGCCACACTGAGGAGGG - Intergenic
920263266 1:204703957-204703979 GAGCCCTGCAGAACTGAGGATGG + Intergenic
1064089328 10:12370140-12370162 GTGCCCTGGGGCAATGATAATGG + Intronic
1067136578 10:43613774-43613796 GTGCTCTCACACACTGATGAAGG - Intronic
1071710238 10:88042610-88042632 GCGCCCTGCGGCTCTGATTAAGG + Intergenic
1075078977 10:119370138-119370160 GGCCCCTGCCTCTCTGATGAGGG - Intronic
1075608471 10:123833272-123833294 GTGCCCAGCCGCCCTGGTGTAGG + Intronic
1077358946 11:2131251-2131273 GTGCCCTGCCTCTCAGAGGAGGG - Intronic
1078355334 11:10628301-10628323 GTGCCCTGCCGCACTGATGAGGG + Intronic
1080839048 11:35967384-35967406 GTGCCTTGCAGCACTGTTGATGG + Intronic
1085755816 11:79200436-79200458 GTCCCTTCCAGCACTGATGAAGG - Intronic
1088389248 11:109295986-109296008 GTGTCTTGCCGCAATGTTGATGG + Intergenic
1093738465 12:22652468-22652490 GTGCCCTTGTGCACTGTTGATGG - Intronic
1097899933 12:64862508-64862530 CTGCCCTGCCCCAGGGATGATGG - Intronic
1104056859 12:125237225-125237247 GTCACCTGCGGCACTGGTGACGG - Intronic
1104760034 12:131292251-131292273 GTGCCCTGCAGCACAAATGCTGG - Intergenic
1105026418 12:132852278-132852300 GTGCCCGGCCGATCTGTTGAAGG + Intronic
1113759519 13:112837762-112837784 GTGCCCGACGGCACTGATGATGG - Intronic
1116747860 14:48844899-48844921 GTGCCCAGCCACACTGAGGGTGG - Intergenic
1117971451 14:61254874-61254896 AAGCCATGCTGCACTGATGATGG - Intronic
1120823129 14:88931359-88931381 GTGCCCAGCTGCTCTCATGAGGG - Intergenic
1122083037 14:99280105-99280127 GTGCCCTGCCCGACCTATGACGG + Intergenic
1126768605 15:52033322-52033344 GTGCCCACCCACACTGATGAGGG - Intronic
1131378476 15:91944763-91944785 CTTCCCTGCAGAACTGATGATGG + Intronic
1132336068 15:101049509-101049531 GTGCCCTGCAGGACCGATGGGGG - Intronic
1135040812 16:19115335-19115357 TTGCCCTGCCGCACTGACTACGG + Exonic
1140671441 16:77283831-77283853 GTGAGCTGCCGCTGTGATGAAGG - Exonic
1142814532 17:2414881-2414903 GGCGCCTGCCCCACTGATGATGG - Intronic
1145780228 17:27557918-27557940 GAGCTCTGCCGCACGGATCATGG + Intronic
1151069065 17:71187373-71187395 GTGCCCACCCTGACTGATGAGGG + Intergenic
1151444955 17:74157422-74157444 GTGCCCACCCACACTGAGGATGG - Intergenic
1155686437 18:28557555-28557577 GAGCCCTGCCTCAGTGTTGATGG - Intergenic
1156133423 18:34006396-34006418 ATGCCCAGCCACACTGGTGAGGG - Intronic
1160016073 18:75141704-75141726 GTGGCCTGGAGCACTGAGGAAGG - Intergenic
1164780027 19:30884623-30884645 GTGTCCTGCCGCAGGGCTGAGGG - Intergenic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
925683654 2:6449040-6449062 GGGCCCTGCCTCCGTGATGACGG - Intergenic
928172726 2:29013738-29013760 GTGCCCACCCACACTGAGGATGG + Intronic
935224474 2:101041071-101041093 GAACCCTACCGCACTGCTGATGG + Intronic
936074934 2:109395721-109395743 GTGACCTGTGGCACTGCTGAGGG + Intronic
938368665 2:130755631-130755653 GTGCTCTGCCGCAGTCTTGAGGG - Intronic
948995071 2:241573890-241573912 GTGCCATGCTGCACTGGGGAGGG - Exonic
1169907695 20:10620012-10620034 CTGCCCTGCACCACTGAGGATGG - Intronic
1170573662 20:17647107-17647129 GTGCCCAGCAGCCCTGATCAGGG + Intronic
1178082840 21:29082670-29082692 CTGCCCTGCCACACTGATCCTGG - Intronic
1180116649 21:45710733-45710755 GTGCTCTGCCTCACTGAGGATGG + Intronic
950425464 3:12922767-12922789 AGGCCCTGCCCCACAGATGAGGG - Intronic
952508022 3:34025176-34025198 GTGCCCTGCCATACTGATTCTGG - Intergenic
954815719 3:53278897-53278919 GTGCTCAACCGCACTGCTGAGGG - Intergenic
955807243 3:62749855-62749877 GTGCCCTGACGCACTGAGGCTGG - Intronic
961026290 3:123560855-123560877 GTGCCCAGCCACACTGCTGAAGG + Intronic
962348161 3:134637296-134637318 GGCCCATGCCTCACTGATGATGG - Intronic
968188731 3:196652029-196652051 GAGCCCTGCCACACTGAGGAGGG + Intronic
968795243 4:2699313-2699335 ATGCCCTGCCGCACCTGTGAGGG + Intronic
969888845 4:10240855-10240877 GTGCCCTTCCAGACTGAGGATGG + Intergenic
971078884 4:23183927-23183949 GTGCCCACCCACACTGAGGATGG + Intergenic
973673697 4:53241984-53242006 GTGCCCTTTTGCACTGCTGATGG - Intronic
973715382 4:53670701-53670723 CAGCCCTGCCACACTGGTGAGGG + Intronic
976690263 4:87861437-87861459 GTGCCCACCTGCATTGATGAGGG - Intergenic
980792139 4:137633385-137633407 GTGCCCACCCACACTGAGGATGG - Intergenic
980907603 4:138963358-138963380 ATGCCCACCCACACTGATGACGG + Intergenic
983752983 4:171299124-171299146 GTGCCCTTCCACACTGTGGAAGG + Intergenic
984226373 4:177040074-177040096 GTTCCCTGCAGCACTGACCAGGG - Intergenic
986997721 5:13626244-13626266 GTGCCCACCCACACTGAAGATGG + Intergenic
987147727 5:15008783-15008805 GTGGCCTGCTGCAGTGATGTGGG + Intergenic
994207027 5:97046883-97046905 TTGCCCTGCCGTCCTGATCATGG + Intergenic
999429204 5:151511536-151511558 GCTCCCTGCAGCATTGATGATGG + Intronic
1001435047 5:171693560-171693582 TTGCCCTGCCCGAGTGATGATGG - Intergenic
1001648008 5:173296728-173296750 CTGCACTGCCACTCTGATGAGGG + Intergenic
1002121109 5:177005867-177005889 GTGCCCTGCCGCTCAGTTAACGG - Intronic
1002137518 5:177117075-177117097 GGGCCCTGCCGCACTCAGGTCGG - Intergenic
1004249559 6:14012392-14012414 ATGCCCTTCCACACTGAGGAGGG + Intergenic
1005382837 6:25254782-25254804 GTGCTCTGAGGCACTGCTGACGG + Intergenic
1006134042 6:31884975-31884997 GTGCTCTGCAGCCCAGATGATGG + Exonic
1006421244 6:33935512-33935534 GGGCCCTGCCTGACAGATGAGGG - Intergenic
1007740443 6:44006424-44006446 CTGCCCCTCCCCACTGATGAAGG - Intergenic
1013836382 6:114341323-114341345 GTGCCCTGAAGCACTGAAGTAGG + Intronic
1019664999 7:2247380-2247402 GTCCCCTGCCCCACAGAGGAGGG - Intronic
1023998112 7:45174366-45174388 GTGGCCAGCCGCACACATGAGGG - Intronic
1024632045 7:51257176-51257198 GTGCCCTGCAGCCCTCATGCTGG + Intronic
1027628589 7:80574995-80575017 GTGCCCTGCAGTCCTGCTGATGG + Intronic
1027840792 7:83308444-83308466 GTGCCCACCCACACTGAGGATGG + Intergenic
1029408831 7:100395754-100395776 GGGCCCTTGCGCACTGTTGATGG + Intronic
1032154845 7:129459347-129459369 GTGTCCTGAAGCACTGATGTGGG + Intronic
1032835377 7:135667854-135667876 TTGCCCAGCCCCACTCATGAAGG + Intronic
1033153676 7:138937940-138937962 GTGCTCTGCCGCAGTCAGGAGGG + Intronic
1034298267 7:149993128-149993150 GTGCCCACCCACACTGAGGATGG + Intergenic
1034807751 7:154103655-154103677 GTGCCCACCCACACTGAGGATGG - Intronic
1035228676 7:157447945-157447967 GAGCCCTAATGCACTGATGATGG - Intergenic
1041604221 8:59761479-59761501 GTCCCCTTCCGCACTGCGGAGGG - Intergenic
1045426046 8:102066830-102066852 GTGCACAGCCCCACTCATGAAGG + Intronic
1045712545 8:105001903-105001925 GTGCTCTGCAGAACTGGTGATGG + Intronic
1045932760 8:107646446-107646468 GTGCCCACCCGGACTGAGGATGG + Intergenic
1049211484 8:141388499-141388521 GAGCCCTGCCACACTGCGGAGGG + Intergenic
1051636360 9:19184192-19184214 CTGGCCTGCCTCACTGAAGAAGG - Intergenic
1054173021 9:61857459-61857481 GTGGCCTGCCCCACTGCTAAAGG - Intergenic
1056602737 9:88059014-88059036 CTGGCCTGCGGCACTGCTGACGG + Intergenic
1059331467 9:113538325-113538347 CTGCCCTGCCCCACTGATCCTGG + Intronic
1060939317 9:127534590-127534612 GGGCCCTGCCTCAGTGATGGGGG + Intronic
1061464038 9:130763816-130763838 GTGCCCTCCCTCACTGAATAGGG - Intronic
1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG + Intergenic
1187701511 X:21968171-21968193 GGGCCCTGCAGCACTGCTGCTGG - Intronic
1187725408 X:22197310-22197332 GTCCCCTGCCACACTGAGTAAGG + Intronic
1199483402 X:148323375-148323397 GGGGCCTGGGGCACTGATGATGG + Intergenic
1199997113 X:153032467-153032489 GTGCCCAGGCGCACTCATGACGG - Intergenic