ID: 1078355555

View in Genome Browser
Species Human (GRCh38)
Location 11:10629333-10629355
Sequence GAAGGATCCTAGGCCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078355555_1078355568 13 Left 1078355555 11:10629333-10629355 CCCCAGAGGGCCTAGGATCCTTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1078355568 11:10629369-10629391 AGATCAAGGGAAGGGAGCCCAGG 0: 1
1: 0
2: 4
3: 38
4: 303
1078355555_1078355561 -1 Left 1078355555 11:10629333-10629355 CCCCAGAGGGCCTAGGATCCTTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1078355561 11:10629355-10629377 CCCAGCACCCACAGAGATCAAGG 0: 1
1: 0
2: 5
3: 43
4: 430
1078355555_1078355565 5 Left 1078355555 11:10629333-10629355 CCCCAGAGGGCCTAGGATCCTTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1078355565 11:10629361-10629383 ACCCACAGAGATCAAGGGAAGGG 0: 1
1: 0
2: 4
3: 48
4: 315
1078355555_1078355564 4 Left 1078355555 11:10629333-10629355 CCCCAGAGGGCCTAGGATCCTTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1078355564 11:10629360-10629382 CACCCACAGAGATCAAGGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 254
1078355555_1078355563 0 Left 1078355555 11:10629333-10629355 CCCCAGAGGGCCTAGGATCCTTC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1078355563 11:10629356-10629378 CCAGCACCCACAGAGATCAAGGG 0: 1
1: 0
2: 3
3: 32
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078355555 Original CRISPR GAAGGATCCTAGGCCCTCTG GGG (reversed) Intronic
902425659 1:16319620-16319642 AAAGGATCCTAGGCCAGGTGTGG + Intronic
902757385 1:18557971-18557993 GAAAGAGCCTCGGCCCTCAGAGG + Intergenic
904198569 1:28804279-28804301 GAAGAATGCAAGGCCCCCTGGGG + Intergenic
905119233 1:35668995-35669017 GAAGAATCCCAGGTCATCTGTGG + Intergenic
910582976 1:88848525-88848547 GAAAGATGCTGGGGCCTCTGTGG + Intergenic
910724264 1:90322205-90322227 GATGGGTCCTAGGCCCCCAGTGG + Intergenic
911086312 1:93980265-93980287 GAAGGATTCTGGGCACTCTGGGG + Intergenic
911446548 1:98000753-98000775 AAAGTATCCTATGTCCTCTGAGG + Intergenic
913596545 1:120384470-120384492 GAAGGGCCTTAAGCCCTCTGGGG + Intergenic
914307883 1:146439703-146439725 GAAGGGCCTTAAGCCCTCTGGGG + Intergenic
914594226 1:149133430-149133452 GAAGGGCCTTAAGCCCTCTGGGG - Intergenic
916533772 1:165683381-165683403 GAATGAACCCATGCCCTCTGAGG + Intronic
918113990 1:181482084-181482106 GGAGGAGGCTAGGACCTCTGGGG - Intronic
918339171 1:183553054-183553076 GCAGGGGCCTGGGCCCTCTGTGG - Exonic
919931526 1:202224390-202224412 TAAGGATCCCAGTCCCTCTGCGG - Intronic
920502317 1:206493132-206493154 GAAGGATTCTAGGTGCTCTGGGG + Intronic
920656641 1:207881175-207881197 GCATGATCCAAGGTCCTCTGGGG + Intergenic
1063077929 10:2734970-2734992 GAAGGATCGAAGGCTGTCTGAGG - Intergenic
1063746438 10:8888885-8888907 CATGGCTCCTAGGCCCTCTGAGG - Intergenic
1065112246 10:22451861-22451883 GTAGATTCCTAGGCCCACTGTGG - Intronic
1069791521 10:71025805-71025827 CCAGGATCCTCGGGCCTCTGTGG + Intergenic
1070789634 10:79181538-79181560 CAAGGTTCCTAGGCCCTCCCAGG + Intronic
1073482776 10:103797509-103797531 GAAGGTTCCTTGTCCCTTTGGGG - Intronic
1076896199 10:133313483-133313505 GATGGATCCTGCACCCTCTGGGG - Intronic
1078355555 11:10629333-10629355 GAAGGATCCTAGGCCCTCTGGGG - Intronic
1083089343 11:60184089-60184111 GCAGAATCCATGGCCCTCTGTGG - Intronic
1083890887 11:65595327-65595349 GATGGAGCCCAGGCCCTGTGAGG - Intronic
1089964988 11:122648360-122648382 TAAGGATCTTAGGCCAGCTGTGG + Intergenic
1090393790 11:126406230-126406252 GCAGGATCCTGGGACCTCTGGGG + Intronic
1090644096 11:128753442-128753464 GAAGGAATGTAGTCCCTCTGAGG + Intronic
1090806934 11:130208710-130208732 GAAAGGCCCCAGGCCCTCTGCGG - Intronic
1097744983 12:63291705-63291727 GCAGCATCCTAGGCCTTCTTGGG + Intergenic
1097960663 12:65529128-65529150 GAAGGGTTCCAGCCCCTCTGAGG - Intergenic
1098140757 12:67448258-67448280 AAAGAAACCTAGGACCTCTGAGG - Intergenic
1104275709 12:127325439-127325461 GAAGGCTCTTGGGGCCTCTGGGG + Intergenic
1105016086 12:132787543-132787565 GAAGGGTCCTGGGGGCTCTGGGG - Intronic
1113775794 13:112944023-112944045 GGAGGATCCTAGGCCGTGAGGGG + Intronic
1117035329 14:51722230-51722252 GCAGGATCCTGTGCCTTCTGTGG + Intronic
1121573118 14:94962287-94962309 GGAGGATGCTAGGTCCCCTGTGG - Intergenic
1121853472 14:97245376-97245398 CAAGGATCGGAGGCCTTCTGAGG + Intergenic
1122932403 14:104940308-104940330 GAAGGATCCACGTCTCTCTGTGG + Exonic
1124533537 15:30525462-30525484 GAAGGAGCCTCGGCCCTATCGGG + Intergenic
1124651260 15:31476084-31476106 TAAGGAGCTTAGTCCCTCTGTGG + Exonic
1124765118 15:32482183-32482205 GAAGGAGCCTCGGCCCTATCGGG - Intergenic
1124876618 15:33600969-33600991 GAAGGATAAAAGACCCTCTGTGG - Intronic
1127966203 15:63924649-63924671 GAATAAGCCCAGGCCCTCTGGGG + Intronic
1129826952 15:78640692-78640714 GAAGGAGCCTCGGCCCTGTTGGG + Intronic
1133015251 16:2936753-2936775 GAATGACCCGGGGCCCTCTGGGG - Intronic
1134477190 16:14585089-14585111 GATGGAGCCCAGGCTCTCTGAGG - Intronic
1134804418 16:17112648-17112670 GAAGGAACCTAAGACCTCTAAGG + Intronic
1138007997 16:53355315-53355337 GAAGGACCCTCGGCCCTATCGGG - Intergenic
1144999270 17:19292148-19292170 GAAGGATCCTGGGCCAGCTGAGG + Intronic
1146917416 17:36687045-36687067 GACCTAACCTAGGCCCTCTGGGG - Intergenic
1149251149 17:54770981-54771003 GAAGCAACCTTGGCCCTCAGTGG - Intergenic
1151167376 17:72217083-72217105 GAAGGATCAGATGCCCTCAGAGG + Intergenic
1152007826 17:77693573-77693595 GCAGGATCCTGGGCCAACTGGGG + Intergenic
1154350648 18:13580445-13580467 GATGCATCCCTGGCCCTCTGGGG - Intronic
1156337787 18:36186219-36186241 CAAGGATCCTAGGGCATCTGCGG + Intergenic
1157285610 18:46375151-46375173 GAAGGAGCCTGGGGCCTCTGAGG - Intronic
1160624604 18:80194675-80194697 GGAGGATCCTAGGCCACGTGGGG + Intronic
1161123671 19:2544236-2544258 GAAGGCTCCGAGGCACTGTGAGG + Intronic
1161206318 19:3042913-3042935 GGGGAATCCTAGGCCCTCAGAGG + Intronic
1161593074 19:5137427-5137449 GAAGGAACCCAGGCCCACGGAGG - Intronic
1161818955 19:6517171-6517193 GATGGATCCTAGGTGGTCTGAGG + Intergenic
1166750403 19:45161762-45161784 GAAGGCCCCTCGGCTCTCTGGGG + Intronic
1166767211 19:45258848-45258870 GAAGGATGCTTGGCTCTCTGGGG + Intronic
1166980899 19:46631487-46631509 CTAGGATCCCAGGACCTCTGAGG - Intergenic
1167563171 19:50238740-50238762 GAAGGATCCTAGGCCAGTCGTGG - Intronic
1167782402 19:51607543-51607565 AAAGGATCCTGGGGCCTCAGTGG - Intergenic
925605243 2:5653832-5653854 GAAGGGCCTTAAGCCCTCTGGGG + Intergenic
926315702 2:11708116-11708138 GAAGGAAACTAGGCCCTAAGAGG + Intronic
930034170 2:47075231-47075253 AAAGGATCCAGGGTCCTCTGTGG - Exonic
932275125 2:70445758-70445780 GGCTGATCCTAAGCCCTCTGGGG + Intergenic
933759936 2:85666142-85666164 GTAGTTTCCTAGGCCCTTTGTGG + Intronic
938017936 2:127883562-127883584 GAAGCCTCCCAGCCCCTCTGAGG - Intronic
938759698 2:134412725-134412747 GAAGGCTCCCAGGCCCTGGGGGG - Intronic
944260135 2:197667966-197667988 GGAGGGTCCTTGGCCCCCTGGGG + Intronic
946739772 2:222790116-222790138 GAAGGAGACCAGTCCCTCTGTGG + Intergenic
948179046 2:235965803-235965825 GAAAGATCTTGGGACCTCTGAGG + Intronic
1169966233 20:11220673-11220695 CAAGAATGTTAGGCCCTCTGAGG - Intergenic
1172604478 20:36205524-36205546 GAAGGGTCCTGGCCCATCTGTGG + Intronic
1173896143 20:46552109-46552131 GAAGTGTGTTAGGCCCTCTGAGG - Intergenic
1173955720 20:47031167-47031189 GAAGGACGCCAGGCTCTCTGAGG + Intronic
1176514753 21:7775494-7775516 GGAGAATGCCAGGCCCTCTGTGG - Intergenic
1176583437 21:8550967-8550989 GAAGGATCCAGGGTCCTGTGGGG + Intergenic
1178648866 21:34406018-34406040 GGAGAATGCCAGGCCCTCTGTGG - Intronic
1180193533 21:46180817-46180839 GGGGGCTCCAAGGCCCTCTGTGG + Intronic
1180854142 22:19035821-19035843 AAAGTAGCCTAGGTCCTCTGGGG - Intergenic
1181020648 22:20100417-20100439 GAGGCTTCCAAGGCCCTCTGGGG + Intronic
1182108280 22:27704660-27704682 GATGGGTCCTAGGCCCTTTCTGG + Intergenic
1183208283 22:36434001-36434023 GAAGGGCAGTAGGCCCTCTGGGG - Intergenic
1183473991 22:38025983-38026005 GAAGATTCCAGGGCCCTCTGAGG - Intronic
1184230500 22:43155997-43156019 GGAGTTTCCTAGGGCCTCTGGGG - Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955027115 3:55178977-55178999 GATGTATCCTCGGCCCTCTTTGG - Intergenic
958922398 3:100121815-100121837 GAAGGATGCTGGGACCTCAGAGG + Intronic
961647505 3:128400391-128400413 GCTGAATCCAAGGCCCTCTGTGG + Intronic
963188998 3:142448089-142448111 GCAGGATCCGAGGCCGTCCGAGG + Intergenic
963981101 3:151537956-151537978 GAGGGATCCTAGCTGCTCTGAGG - Intergenic
967405286 3:189109005-189109027 GAAGAAGCCTAAGCCCTCAGGGG + Intronic
968826341 4:2900464-2900486 CAAGGATACTGGCCCCTCTGAGG - Intronic
969528692 4:7717613-7717635 GCAGGACCCCAGGCCCTCTTGGG + Intronic
983518084 4:168678064-168678086 GCATGAAGCTAGGCCCTCTGAGG + Intronic
985947163 5:3194819-3194841 GAAGGATCCGCCGTCCTCTGGGG - Intergenic
987299553 5:16585343-16585365 GATGGAACCAAGGCCATCTGAGG + Intronic
994153288 5:96474329-96474351 GAAAGTTCCTGGGCCCTCAGAGG - Intergenic
996824745 5:127669422-127669444 GGAGGAGCCAAGGCCTTCTGGGG + Intergenic
997691174 5:135828517-135828539 GGAGGATCATAGCCCTTCTGAGG + Intergenic
999069048 5:148724145-148724167 GAAGCATCCTAGGCCCGGTGAGG + Intergenic
999696800 5:154194394-154194416 AAAGGATACTAGCCCTTCTGTGG - Intronic
1000384235 5:160658672-160658694 GAAGGTTGCTAGACCCTCTCTGG + Intronic
1002254614 5:177949914-177949936 GGAGGAGCCGAGGCCCACTGGGG + Intergenic
1002483378 5:179517898-179517920 GGAGGAGCCGAGGCCCACTGGGG - Intergenic
1004003257 6:11615147-11615169 GCATGGTCCTAGGCCCACTGAGG - Intergenic
1004267320 6:14160124-14160146 GAAGGTTCCCAGTCCCTCTCAGG - Intergenic
1005105487 6:22220459-22220481 GAAGTTTCCTAGGCCCCCTAGGG - Intergenic
1015399017 6:132768004-132768026 CAAGGATTCGAGGCTCTCTGGGG - Intergenic
1015904438 6:138102605-138102627 AAAGGAACCGAGGCTCTCTGGGG + Intronic
1021837204 7:24690271-24690293 GAAGAACCCTGGGACCTCTGGGG - Exonic
1022854006 7:34297814-34297836 GAAGGATCCAAGGACCCCTGAGG + Intergenic
1025056057 7:55765996-55766018 GAAGCCTCCTATCCCCTCTGTGG + Intergenic
1026042935 7:66883836-66883858 GAATGATCCTAGGCCAGGTGCGG - Intergenic
1026614898 7:71893146-71893168 GAAGGATCCTGCACCCTCAGGGG + Intronic
1029193988 7:98791521-98791543 GATGGACCCCAGGGCCTCTGAGG - Intergenic
1029643587 7:101836909-101836931 GAAGGAACCTGGGCCCTCGATGG + Intronic
1035475147 7:159138174-159138196 GGAGGGTCCAAGGCCCTGTGTGG - Intronic
1036773263 8:11592997-11593019 GAAAGCTCCCAGGCCCTGTGAGG - Intergenic
1037639273 8:20728011-20728033 GAACAATGCTAGGCCCTGTGAGG + Intergenic
1038844337 8:31214940-31214962 GAAGGATACTGGGCTCTCTCAGG + Intergenic
1040063658 8:43126526-43126548 GGAGGACCCCAGGCCCTCAGAGG - Intergenic
1045526045 8:102942200-102942222 GCAGGATCTTAGGGCCTCAGAGG + Intronic
1059335015 9:113563633-113563655 GAAGGTTCCTAGGCCCTGCAAGG + Intronic
1061060435 9:128247518-128247540 GCATGATCCTAGGGCCCCTGGGG + Intronic
1061421130 9:130473367-130473389 GAAGGGTCCAAGGTCCTCTCAGG + Intronic
1062344036 9:136106713-136106735 GAAGGATGCTAGACCCTCTCTGG - Intergenic
1062583610 9:137238945-137238967 GCAGGACCCCAGTCCCTCTGAGG + Intergenic
1186717628 X:12269319-12269341 GAAGAATCTGAGGCCATCTGAGG - Intronic
1187804456 X:23103651-23103673 CTAGGATCATAGGCCCTCTTAGG + Intergenic
1190833688 X:54081360-54081382 GAAGGATCCTCGGCCCCTGGAGG + Exonic
1192103596 X:68291546-68291568 CAAAGCTCCCAGGCCCTCTGAGG - Intronic
1195124604 X:101794482-101794504 GAAGGAATGTAGGCCCTGTGTGG + Intergenic
1197454772 X:126665520-126665542 GAAGAATACTAGGGACTCTGAGG - Intergenic
1199882686 X:151987330-151987352 GAAGGATCCTTGACCTCCTGAGG + Intergenic
1201772546 Y:17629867-17629889 GAAGGATCCTAGAGCAACTGTGG - Intergenic
1201829009 Y:18276120-18276142 GAAGGATCCTAGAGCAACTGTGG + Intergenic