ID: 1078355727

View in Genome Browser
Species Human (GRCh38)
Location 11:10630134-10630156
Sequence CAATGTGACTGGAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 413}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078355727_1078355735 11 Left 1078355727 11:10630134-10630156 CCACCTTCCCTCCAGTCACATTG 0: 1
1: 0
2: 2
3: 43
4: 413
Right 1078355735 11:10630168-10630190 TTTCTCCAAAACTGCCCCTCTGG 0: 2
1: 1
2: 0
3: 18
4: 186
1078355727_1078355737 17 Left 1078355727 11:10630134-10630156 CCACCTTCCCTCCAGTCACATTG 0: 1
1: 0
2: 2
3: 43
4: 413
Right 1078355737 11:10630174-10630196 CAAAACTGCCCCTCTGGATGAGG 0: 1
1: 0
2: 2
3: 14
4: 141
1078355727_1078355739 21 Left 1078355727 11:10630134-10630156 CCACCTTCCCTCCAGTCACATTG 0: 1
1: 0
2: 2
3: 43
4: 413
Right 1078355739 11:10630178-10630200 ACTGCCCCTCTGGATGAGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 155
1078355727_1078355743 28 Left 1078355727 11:10630134-10630156 CCACCTTCCCTCCAGTCACATTG 0: 1
1: 0
2: 2
3: 43
4: 413
Right 1078355743 11:10630185-10630207 CTCTGGATGAGGTGGGTGAACGG 0: 1
1: 0
2: 0
3: 37
4: 292
1078355727_1078355738 20 Left 1078355727 11:10630134-10630156 CCACCTTCCCTCCAGTCACATTG 0: 1
1: 0
2: 2
3: 43
4: 413
Right 1078355738 11:10630177-10630199 AACTGCCCCTCTGGATGAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078355727 Original CRISPR CAATGTGACTGGAGGGAAGG TGG (reversed) Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901532138 1:9860231-9860253 CAATGTCACTGGAGAAAAAGGGG + Intronic
901744765 1:11364934-11364956 AATTGTGACTGAAGTGAAGGGGG - Intergenic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902097511 1:13958807-13958829 CAATGTGGCTGGAGCCAAGGCGG + Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902416457 1:16242639-16242661 CCAGGTGACTGGATGGATGGTGG + Intergenic
903370143 1:22830045-22830067 AAGTTTGACTGGTGGGAAGGGGG + Intronic
903456706 1:23492447-23492469 CAATGTGACTGGAGCAGGGGAGG - Intergenic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904506919 1:30964697-30964719 CCATGTGAAGAGAGGGAAGGAGG + Exonic
904875258 1:33649935-33649957 CAAGGTGCCAGGTGGGAAGGAGG - Intronic
904925816 1:34047420-34047442 AAATGGGACAGGAGGGGAGGAGG - Intronic
904981855 1:34510484-34510506 CAATATTAGTGGAGGTAAGGTGG + Intergenic
905120623 1:35679179-35679201 CAATGTGTCTGGGGCCAAGGCGG + Intergenic
905514956 1:38555839-38555861 CAGGGTTACTGGAGGGAAAGGGG + Intergenic
905866509 1:41379771-41379793 CCAGGAGACTGGTGGGAAGGAGG + Intronic
906110073 1:43316854-43316876 CAATGTGAGTCAATGGAAGGAGG - Intronic
906976664 1:50581675-50581697 CAATGTGAGAGAAGGGGAGGAGG + Intronic
908771903 1:67605127-67605149 CAATGAGCCAGGAGAGAAGGAGG - Intergenic
909512366 1:76468875-76468897 ACATGTGAATGGAAGGAAGGAGG + Intronic
909701631 1:78531010-78531032 CAATGTGTCTTCAAGGAAGGAGG - Intronic
909731742 1:78900276-78900298 CAATGTCTCTGGAGGGACTGCGG - Intronic
910778804 1:90903991-90904013 CACTGTGACAGCAGTGAAGGAGG + Intergenic
911058044 1:93724280-93724302 CAATGGGACTGGTGTGATGGTGG - Intronic
911236684 1:95419775-95419797 AAATGTGTCTGGAAGAAAGGAGG - Intergenic
911787186 1:101965841-101965863 CAATGTGTTTGCAGGGAAAGGGG + Intronic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
913171885 1:116240566-116240588 ACTTGTGACTGGTGGGAAGGAGG + Intergenic
913526387 1:119697393-119697415 CATTGTGACTGGTGGGACAGTGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
916316313 1:163452043-163452065 CAAAGAGACTGAAGGCAAGGTGG + Intergenic
916607877 1:166360986-166361008 GAATGTGACAGGAAAGAAGGAGG + Intergenic
916745409 1:167681311-167681333 TAATGTGCCTGGAGGGCAGACGG + Intronic
917397067 1:174604628-174604650 AAAAGTGTCTGGAGAGAAGGTGG - Intronic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919417983 1:197335175-197335197 TAGTGTGACTGGAGTGAAGGAGG + Intronic
919493108 1:198229479-198229501 GACTGTGACTGGTGGAAAGGGGG + Intronic
920572041 1:207024709-207024731 CCTTGTCCCTGGAGGGAAGGAGG - Intronic
920726322 1:208438574-208438596 CAATGTTTCTGGAGTGAGGGAGG + Intergenic
921551591 1:216542921-216542943 CCATGTGCTTGGGGGGAAGGGGG - Intronic
921774782 1:219084403-219084425 TAATATGACTGGAGTGAAGTGGG - Intergenic
923109566 1:230879925-230879947 CAGGGTGACTGGAGAGATGGAGG - Intergenic
923554557 1:234990545-234990567 CAATATGACTGGAGGAAATTTGG - Intergenic
923982020 1:239335766-239335788 CAATGTAACAGTAGAGAAGGAGG + Intergenic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1063347443 10:5325153-5325175 CATTGTGACAGCAGAGAAGGTGG + Intergenic
1063458535 10:6201707-6201729 GGCTGTGATTGGAGGGAAGGCGG - Intronic
1063518849 10:6722693-6722715 GAAAGAGACTGGAGGAAAGGAGG + Intergenic
1064180296 10:13108981-13109003 AAATGTAACTGGAGAGAAAGTGG + Exonic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065486149 10:26238091-26238113 CAATGCCACTTGAGGTAAGGAGG + Intronic
1065612986 10:27490950-27490972 CAATGGGACTGGCAGGAATGAGG + Intergenic
1065739520 10:28784556-28784578 CCATGGGATTGGGGGGAAGGAGG - Intergenic
1067193305 10:44091027-44091049 CAATGTGACTGGTCTGAAAGTGG + Intergenic
1068944733 10:62718446-62718468 CAAGATCACTGGAGGGAAGGAGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1070272675 10:74972314-74972336 CAATTTCCCTGGAGTGAAGGTGG - Intronic
1070282425 10:75059391-75059413 AAAGGAGACTGGAGAGAAGGAGG + Intergenic
1070662925 10:78320377-78320399 AAATGTGGCTGGAAGGGAGGTGG + Intergenic
1070822131 10:79364278-79364300 AAATGTTACTGGAGGCATGGTGG + Intergenic
1070939263 10:80328915-80328937 TACTGTGGCTGGAGGGAAGGAGG - Intergenic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1071712688 10:88065076-88065098 CAATATGACTGAAAGGAAAGAGG - Intergenic
1072691689 10:97576218-97576240 CAATGTGGCAGCTGGGAAGGAGG - Intronic
1072923487 10:99596212-99596234 CAAAGAGACTGGTGGGAAAGAGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075406468 10:122199002-122199024 CAATGTCCCTGAAGGGCAGGTGG - Intronic
1076263411 10:129090243-129090265 CATTGGGACTGGAGTGAGGGTGG + Intergenic
1078324286 11:10366963-10366985 CAAAGTGACTGGTTTGAAGGGGG + Intronic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078421110 11:11213701-11213723 CAGTATGATTGGAGGAAAGGAGG - Intergenic
1078484361 11:11707854-11707876 CAGGGTCACTGGAGTGAAGGTGG + Intergenic
1078759480 11:14240739-14240761 CAATGTGGGTGGAGTGAAGGTGG - Intronic
1079521485 11:21332310-21332332 CAAGGTGACTGGAATTAAGGGGG - Intronic
1079761518 11:24335332-24335354 CAATGTGACATGAGTGAATGTGG + Intergenic
1080224520 11:29945381-29945403 CAATTTGATTGGATTGAAGGAGG + Intergenic
1081549183 11:44096210-44096232 CCCTGTGGCTGGCGGGAAGGTGG - Exonic
1081665982 11:44917435-44917457 GAATAAGATTGGAGGGAAGGTGG - Intronic
1085554207 11:77404667-77404689 CATTGTAACTGGAAGGAAGAAGG - Intronic
1086967209 11:93042027-93042049 GAAAGTAACTGCAGGGAAGGAGG - Intergenic
1088977689 11:114830351-114830373 CACTTTGTCTGGAGGGGAGGAGG + Intergenic
1089184297 11:116604240-116604262 GAATGCCACTGGAGGGGAGGTGG - Intergenic
1089383481 11:118052656-118052678 GGATGTGGCTGGAAGGAAGGGGG - Intergenic
1089396745 11:118141096-118141118 GAATGGGAATGGGGGGAAGGAGG + Intronic
1089634358 11:119802949-119802971 CAGTGTGACTGGTGGAAAAGTGG + Intergenic
1089869615 11:121660490-121660512 CTATGTGACTGGAAGGTAGTAGG + Intergenic
1090268838 11:125371537-125371559 GAAGGAGACTGGAGGGGAGGAGG - Intronic
1090961396 11:131560595-131560617 AGATGTGACTGGAAGAAAGGAGG - Intronic
1091601948 12:1923090-1923112 AAATGTGATTGGAATGAAGGAGG + Intergenic
1092223138 12:6729133-6729155 GAATGGGAGTGGAGGGCAGGTGG + Intronic
1092952827 12:13524115-13524137 CATTGTGCCTGAAGGGAAAGGGG + Intergenic
1095735888 12:45555779-45555801 CAATGGAACTGGAAGGCAGGAGG - Intergenic
1096501947 12:52069660-52069682 CATAGAGACTGGAGGGAAGGAGG - Intronic
1096541702 12:52311531-52311553 AAAAGTGCCTGGAAGGAAGGAGG + Intergenic
1096591084 12:52659601-52659623 GAATCTGCCTGGAAGGAAGGAGG + Intergenic
1096650024 12:53058012-53058034 CAATGTGACTGTGGGGAGAGAGG - Exonic
1096859971 12:54518729-54518751 CAAGGTAACTGGAGGGAGGTGGG + Exonic
1096901858 12:54891487-54891509 CAATGTGTCTGATGGGAATGGGG - Intergenic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097365776 12:58710376-58710398 CATTGAGACTGGTCGGAAGGTGG - Intronic
1097844316 12:64351324-64351346 AAATGTGTCTGCAGGGGAGGGGG - Intronic
1098077931 12:66753315-66753337 AAATGTGAATGGAAGGAATGGGG + Intronic
1099062713 12:77932074-77932096 AAATCTGACTGGAGTGAGGGTGG + Intronic
1099220840 12:79912023-79912045 CAGTGTGACTGGAGCACAGGGGG - Intronic
1099560252 12:84164418-84164440 CAATGTGGCTAGAGTCAAGGAGG + Intergenic
1099916452 12:88901032-88901054 CAAAGGGACTTGAGGGAATGAGG - Intergenic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1100387716 12:94119046-94119068 AAATGTGACTGGTAGGAAGCAGG + Intergenic
1101168591 12:102064147-102064169 GAATGTGACTTGAGGGTAGGTGG + Intergenic
1104241820 12:126997497-126997519 CAACTTGACTGGATTGAAGGAGG + Intergenic
1104268946 12:127264736-127264758 ACTTGTGACTGGTGGGAAGGAGG - Intergenic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1105549036 13:21375233-21375255 AAATGGGACTGCAGGGGAGGGGG - Exonic
1105564572 13:21531523-21531545 CAAAGTCACTGGATGGGAGGAGG + Intronic
1105923161 13:24983752-24983774 AAATGTGACTGGACAGAAAGCGG - Intergenic
1106891526 13:34251210-34251232 CAATGAGATGGGAGGAAAGGTGG + Intergenic
1107515238 13:41122532-41122554 AAATGTGAGTGGAGGGATGGGGG + Intergenic
1107520708 13:41177662-41177684 CAATGTGAGGGGATGGGAGGTGG + Intergenic
1108420546 13:50244768-50244790 GAATGTGACAAGAGGGAAGGTGG - Intronic
1108482838 13:50892287-50892309 CTATGTGGCTGGAGGGGTGGGGG - Intergenic
1109442628 13:62394909-62394931 CACTGTGGGTGGTGGGAAGGAGG + Intergenic
1112075295 13:95906916-95906938 CAATGGGACTGGTTGGAAAGTGG + Intronic
1112160013 13:96857208-96857230 CAAGGTGACAGGCAGGAAGGAGG - Intergenic
1112691698 13:101903616-101903638 CAGGGTGACTATAGGGAAGGAGG + Intronic
1113192282 13:107762553-107762575 CATTGTGTATGGAGGTAAGGCGG + Intronic
1114402269 14:22420844-22420866 TCAGGAGACTGGAGGGAAGGAGG - Intergenic
1114497926 14:23146764-23146786 CCATGTGACTGAGGGGAAAGAGG + Intronic
1114753217 14:25229050-25229072 CAAGTTAACTGGAGGGGAGGAGG + Intergenic
1116277884 14:42860169-42860191 CAATCTGACTCCAGGGAAGGTGG - Intergenic
1116963028 14:50986288-50986310 CAATGTGCCTGGGGGCAGGGAGG + Intronic
1118037056 14:61879134-61879156 CAATGTGCCTGTAAGGAAGAGGG + Intergenic
1118646683 14:67847141-67847163 CAATGAGAATGGATGGAGGGAGG - Intronic
1119196967 14:72724321-72724343 CAATGTGACTGGCGGGCTGCTGG - Intronic
1119768372 14:77205114-77205136 CCCTGTGGCAGGAGGGAAGGTGG + Intronic
1120521994 14:85534483-85534505 GAAGGTGAAGGGAGGGAAGGAGG - Intronic
1121413384 14:93762837-93762859 CTATGTGCCTGGAGTGAAGTTGG - Intronic
1122267829 14:100554886-100554908 CAGCGTGCCTGGCGGGAAGGTGG - Intronic
1122745786 14:103896568-103896590 CCATGTGGCTGGAAGGAAGGCGG - Intergenic
1122805645 14:104255240-104255262 AAATTGGACAGGAGGGAAGGGGG - Intergenic
1124646922 15:31443824-31443846 CAATGGGACGGGAGGGAGGGAGG - Intergenic
1125822884 15:42648760-42648782 TAATGGTAGTGGAGGGAAGGGGG - Intronic
1129596205 15:76966416-76966438 AACTGTGAATGGAGGGAAGGGGG + Intergenic
1129999978 15:80037853-80037875 AAATGTAACTGGGGGGAGGGAGG - Intergenic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1130897818 15:88184292-88184314 CTATGTGTCTGCAGGGGAGGAGG + Exonic
1131150060 15:90042224-90042246 CAAGGAGGCTGGAGAGAAGGGGG - Intronic
1133623616 16:7549871-7549893 CAACGTGATTGGACTGAAGGAGG - Intronic
1134875395 16:17693705-17693727 CGGTGTGCCAGGAGGGAAGGGGG - Intergenic
1135568205 16:23528338-23528360 CAATGGCACTGCAGGGAAGCAGG + Intronic
1136593020 16:31229074-31229096 CATGGTGTCTGGAGGGATGGTGG + Intergenic
1137307153 16:47213600-47213622 CTATGTCACGGGAGGGGAGGGGG + Intronic
1137599040 16:49743777-49743799 CACTGCGACTGGAGGGAGAGGGG - Intronic
1138076682 16:54049707-54049729 CATTCTGCCTGAAGGGAAGGAGG - Intronic
1138085608 16:54131279-54131301 GAAGGAGGCTGGAGGGAAGGAGG + Intergenic
1138223852 16:55276016-55276038 CCATGTGACTGGCGGGCAGGCGG + Intergenic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140219515 16:73033500-73033522 CAACTTGACTGGGGGGAAAGGGG + Intronic
1140487434 16:75304816-75304838 CACTGCGGGTGGAGGGAAGGCGG - Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1142131447 16:88433299-88433321 CACTGTGGAAGGAGGGAAGGTGG + Exonic
1142284373 16:89165743-89165765 CACTGTGACAGGAGGGAGGGAGG - Intergenic
1143701190 17:8661433-8661455 TGATGTGACTGGAGCAAAGGAGG - Intergenic
1143950651 17:10629956-10629978 GAATGTCACTGGAGAGGAGGGGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144127092 17:12213199-12213221 GAATGTGACTGGAAGTAATGTGG + Intergenic
1144416031 17:15048139-15048161 TAATGGAACTGGAGGAAAGGAGG - Intergenic
1145029558 17:19494392-19494414 CAATGTTACTCAAGGGAGGGTGG - Intergenic
1147110106 17:38256227-38256249 CACTGTCACTTGAGGGAAAGGGG + Intergenic
1147214164 17:38889839-38889861 CAACCTAACTGGAGGGTAGGTGG - Intronic
1147426199 17:40346985-40347007 CACTGTGTCTGCAGGTAAGGGGG + Intronic
1147657607 17:42099454-42099476 GAATGTAGCAGGAGGGAAGGAGG + Intergenic
1148419407 17:47532194-47532216 CACTGTCACTTGAGGGAAAGGGG - Intronic
1148921060 17:51034607-51034629 AAACTGGACTGGAGGGAAGGAGG + Intronic
1149179092 17:53912706-53912728 CACTTTGACTAGAGGGATGGGGG - Intergenic
1149821604 17:59784425-59784447 CAATTTGAGAGGAGTGAAGGGGG - Intronic
1150099349 17:62408596-62408618 CAATGTGACTGGTGTGACTGAGG - Intronic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1151546712 17:74797742-74797764 CAGAGTGACTGGAGGAAGGGGGG + Intronic
1151643248 17:75411951-75411973 CAATGAGATTGGAGGTATGGTGG - Intergenic
1152285071 17:79407743-79407765 CAAGGTGGCTTGGGGGAAGGTGG + Intronic
1152330376 17:79669261-79669283 CAACCTGCCTGGAGGGCAGGTGG - Intergenic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1152723045 17:81932123-81932145 CACTGCCTCTGGAGGGAAGGGGG + Intergenic
1153028386 18:691281-691303 CAACGTGACAGGAGGGGAAGAGG + Intronic
1153422729 18:4926391-4926413 GAATGTGAATGGAGGTAGGGAGG + Intergenic
1153661074 18:7326882-7326904 CAATGTCAATGGCGGGATGGTGG + Intergenic
1153684408 18:7530806-7530828 AAATGCAACTGGAGAGAAGGCGG + Intergenic
1155042954 18:22080297-22080319 GAATGTTGCTGAAGGGAAGGTGG + Intergenic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155775993 18:29762356-29762378 CAATGTGGCTGGAGTGAACTGGG - Intergenic
1157807332 18:50667930-50667952 TAATATGACTCGTGGGAAGGAGG - Intronic
1159382734 18:67683580-67683602 AAAGGTGAGTGGGGGGAAGGAGG + Intergenic
1159496561 18:69215037-69215059 CAATGTCACTGGAAGCAAAGAGG + Intergenic
1160046038 18:75388190-75388212 GTATGTGACTGCAGGGAATGGGG + Intergenic
1160776446 19:858752-858774 CAATGTGCCGGGATGGTAGGTGG + Intergenic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162757837 19:12870943-12870965 TAAGGTGAGTGCAGGGAAGGAGG + Exonic
1163035963 19:14569122-14569144 CAAAGTGACTGGCTGAAAGGGGG + Intronic
1163344808 19:16733888-16733910 CAATGTGACTGGAGGAAGAAAGG - Intronic
1163371453 19:16903491-16903513 CTGTGTGATTGGAGGGAATGGGG + Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165641160 19:37388206-37388228 GAATTTAACTGGGGGGAAGGAGG - Intronic
1165837803 19:38770229-38770251 CACTGTGACGGGAGGGGAAGCGG - Intergenic
1165841763 19:38792468-38792490 CACTGTGACGGGAGGGGAAGCGG + Intergenic
1166252411 19:41580444-41580466 ACTTGTGACTGGTGGGAAGGTGG - Intronic
1166266372 19:41687135-41687157 CAATGTCGCAGAAGGGAAGGAGG - Exonic
1166338439 19:42122678-42122700 CAAGGTGGCTGGGGGTAAGGGGG - Intronic
1166763771 19:45240452-45240474 CAATAGGACTGGAGAGAACGGGG + Intronic
1167989082 19:53342550-53342572 CAATGAGGCTGGAAGGAGGGTGG - Intronic
1168134574 19:54341863-54341885 GAATGAGAGTGGAGCGAAGGGGG + Intergenic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
925577917 2:5379894-5379916 AAATGTGTCTGGGGGTAAGGAGG + Intergenic
925769287 2:7266628-7266650 CACTGTATCTGGAGGGAAGGAGG - Intergenic
926344747 2:11935052-11935074 CAATGACACTGGAGGGCATGGGG + Intergenic
926371290 2:12181279-12181301 AAATGTCACTGGAGAGGAGGAGG + Intergenic
928239916 2:29577429-29577451 CAGTCTGAATGGTGGGAAGGTGG + Intronic
928939619 2:36714526-36714548 CCATGGCACTGGAGGGAGGGGGG + Intronic
931420095 2:62119075-62119097 CAATGAGACTGTGGGGCAGGGGG + Intronic
932574096 2:72953371-72953393 ATTTGAGACTGGAGGGAAGGAGG + Intronic
932881204 2:75503763-75503785 AAAGGTGAGTGGAGGGTAGGAGG + Intronic
933792085 2:85890886-85890908 TAATGTGAGTGGAGTGAATGAGG - Intergenic
933807855 2:86013034-86013056 CCTTCTGACTGGAGGCAAGGGGG - Intergenic
934220421 2:90077025-90077047 CAATGTCAGGGGAGTGAAGGAGG + Intergenic
935200935 2:100855993-100856015 GAATGTGTTTGGAGGGAGGGGGG - Intronic
936263534 2:110981916-110981938 AAATGTAGCTGGAAGGAAGGAGG + Intronic
938952726 2:136270340-136270362 ACATGTGGCTGGAGGGCAGGAGG + Intergenic
939002591 2:136753611-136753633 CCAGATGACTGGAGTGAAGGGGG - Intergenic
939446558 2:142317092-142317114 AAATTAAACTGGAGGGAAGGAGG + Intergenic
939697844 2:145349830-145349852 CAAGGTGACTGCTGTGAAGGCGG + Intergenic
940456938 2:153913275-153913297 CAATGTGACAGGTGGGGTGGGGG + Intronic
940464864 2:154014470-154014492 CACTGAGAGTGGACGGAAGGAGG - Intronic
940823195 2:158380939-158380961 CTATGTGACTGTTGGGAAGTAGG - Intronic
941183999 2:162298540-162298562 TTATGAAACTGGAGGGAAGGTGG - Intronic
942848011 2:180449107-180449129 CAATGTGTCTGGAGGTATTGAGG + Intergenic
945273470 2:207964485-207964507 CCATGAGAGTGGAGGGAGGGAGG + Intronic
945678320 2:212882122-212882144 CAAAGTGACTGGAAGGACTGTGG + Intergenic
946550570 2:220797364-220797386 GAATGTGACTGGATGGCAGCGGG - Intergenic
947459461 2:230290667-230290689 CAGTTTGGCTTGAGGGAAGGAGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948667511 2:239545779-239545801 CCAGGTGACAGGAGGGAAGGCGG - Intergenic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168752354 20:291774-291796 CCATGAGACTGGAAGGGAGGGGG - Intergenic
1169150390 20:3285010-3285032 GAATGGGAGTGGAGGGCAGGAGG - Intronic
1169439568 20:5622818-5622840 CAATGTGCATGGAGAGAAGGTGG + Intergenic
1170531611 20:17298395-17298417 GATTGTCACTGGTGGGAAGGTGG + Intronic
1170992698 20:21319134-21319156 AAATGTTACTGGAGGTAAAGAGG - Intronic
1171303898 20:24088480-24088502 CAGTGAAACTGGAGTGAAGGAGG - Intergenic
1171307849 20:24121117-24121139 TAAGGCGACTGGTGGGAAGGGGG + Intergenic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172600271 20:36178352-36178374 CAATGGGACTGGCAGGAAGAAGG - Intronic
1173433448 20:43011838-43011860 CCATGTGACTGGAAGAAAGCAGG + Intronic
1173476846 20:43365633-43365655 CAATGTCAGTAGAGGCAAGGTGG - Intergenic
1173606663 20:44336735-44336757 CAATATGACTTGGGGTAAGGTGG + Intergenic
1174307775 20:49626653-49626675 ACTTGTGACTGGTGGGAAGGAGG - Intergenic
1174752167 20:53122567-53122589 CAAGGTGTTTGGAGGGAAGAGGG + Intronic
1175054789 20:56188433-56188455 CAATGTGACAGGACAGAATGAGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175694728 20:61093222-61093244 AAATGAGACTGGAGAGAGGGTGG - Intergenic
1177576575 21:22964307-22964329 CATTGTTGCTGAAGGGAAGGGGG + Intergenic
1178138077 21:29650804-29650826 GAATGTGGCTGTGGGGAAGGTGG - Intronic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179374822 21:40841235-40841257 CAAGGTGGCAGGAGGGAAGCAGG - Intronic
1180675069 22:17581214-17581236 CCTGGAGACTGGAGGGAAGGGGG - Intronic
1182694011 22:32184465-32184487 CAATCTGAGTGGAGGGGTGGGGG + Intergenic
1183258301 22:36777267-36777289 CTAGGTGTCTGGAGGGAATGTGG - Intergenic
1183341273 22:37283253-37283275 CAATGTGTCTGGGGAGAAAGAGG + Intronic
1183767854 22:39895818-39895840 CAATGTTACGGGAGTGAAAGGGG + Intergenic
1184098534 22:42329582-42329604 CAAGGAGACGGGAGGGGAGGTGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184250326 22:43256530-43256552 TAATGAGAGGGGAGGGAAGGTGG + Intronic
1185085430 22:48738212-48738234 TATTGTCACTGGAGGAAAGGAGG + Intronic
1185241495 22:49749860-49749882 CGCTGTGACTGGTGGGATGGAGG - Intergenic
949747179 3:7308485-7308507 TTATGTGTCTGGAGGGATGGAGG + Intronic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
951632386 3:24736191-24736213 CAATGCTGCTGGAGAGAAGGAGG + Intergenic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
952000283 3:28777366-28777388 TCATGTGACTGGAGGGCTGGTGG + Intergenic
952682988 3:36117303-36117325 CAATGTGATCAGAGGGAAAGAGG + Intergenic
953189034 3:40666235-40666257 CATTGTGGCGGGAGGAAAGGTGG + Intergenic
953405861 3:42659465-42659487 CCATGTGACTGTGGGGAGGGGGG - Exonic
954671093 3:52291771-52291793 CAGTGTGACAGGTGGGATGGGGG - Exonic
954677943 3:52325938-52325960 CTATGAGCCTGGAGGGATGGTGG - Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
959783644 3:110267152-110267174 GAATCTGCATGGAGGGAAGGAGG - Intergenic
960460334 3:117926365-117926387 GATTGTGACTGGGGGGAAGAAGG + Intergenic
960948428 3:122982801-122982823 CAAGGTGCCTGGAGGAAATGGGG - Intronic
961600367 3:128056694-128056716 CAATGTGCCTTGAGGAAACGGGG - Exonic
962081586 3:132145040-132145062 CAATATGAGTGGAGGGTAGTGGG - Intronic
962422508 3:135240866-135240888 CAATGTTGCTGCAGGGGAGGTGG - Intronic
962891512 3:139677053-139677075 GAATGTGGCTTGAGGAAAGGAGG - Intronic
963044253 3:141091012-141091034 CCAAGTGACTGGAAGGATGGAGG + Intronic
964590953 3:158361328-158361350 CACTGCTACTGCAGGGAAGGAGG - Intronic
964612829 3:158632099-158632121 CAATGTGGCTGGAGCAAAAGGGG + Intergenic
967117853 3:186357911-186357933 CAATGTGACTGGTGTGACCGAGG + Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
968410632 4:386824-386846 CAAGGGGACTGGTGGGAAAGTGG - Intergenic
968577103 4:1372549-1372571 CAATGTGATGGGGTGGAAGGAGG - Intronic
968615072 4:1574023-1574045 CAGTGTGGCTGCTGGGAAGGAGG - Intergenic
968951964 4:3700004-3700026 CCTTGTCACTGGAGGGAAAGCGG - Intergenic
969248291 4:5950371-5950393 TAATATGAGTGGAGAGAAGGGGG + Intronic
970500574 4:16672750-16672772 CAGTGTTACTGCAGGGAAAGAGG - Intronic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971969270 4:33600855-33600877 CGGTGTGACTGTAGAGAAGGAGG - Intergenic
972577378 4:40364346-40364368 GGAGGAGACTGGAGGGAAGGAGG - Intergenic
974456414 4:62134168-62134190 ACATGTGACTAGAGGGAAGGAGG + Intergenic
974543791 4:63274825-63274847 CATTGAGAATGGAGGGAGGGAGG + Intergenic
976050357 4:81004677-81004699 CAATGGGCCTGGAGGAAATGAGG + Intergenic
976223640 4:82778280-82778302 AAATGTGACTGGAGGCAGGGTGG - Intronic
977758986 4:100708059-100708081 AAAAGTGGCTAGAGGGAAGGAGG + Intronic
978097277 4:104793368-104793390 CATTGTGTCTGGCAGGAAGGTGG + Intergenic
978116718 4:105027605-105027627 CCATGTTACTAGAGGAAAGGAGG + Intergenic
978493591 4:109334763-109334785 CAATGTGTGTGGAGGGGTGGGGG - Intergenic
980754158 4:137135870-137135892 GAATGAGTGTGGAGGGAAGGGGG - Intergenic
981618912 4:146671766-146671788 CTCTGTGACTGGAGAGAAGGAGG + Intergenic
983249490 4:165327912-165327934 GAAGGAGACTGGAGTGAAGGTGG + Intronic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
983538980 4:168888647-168888669 CAATGAGACTGGAGGAGTGGGGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985030148 4:185781464-185781486 CAATGGCACTGGGAGGAAGGTGG - Intronic
985140428 4:186833771-186833793 GCAGGTGACTGGAGGGAAAGTGG + Intergenic
985164778 4:187081859-187081881 CAATGTGCCTGGAGTCAAGTAGG - Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
987362646 5:17121125-17121147 CAAAGAGAATGGAGAGAAGGTGG + Intronic
988803584 5:34719381-34719403 CAATCTCAATGGATGGAAGGTGG - Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990081172 5:51915442-51915464 ACATGTGACTGGTGGGAAAGAGG + Intergenic
990232436 5:53727930-53727952 GCTTGTGACTGGTGGGAAGGAGG + Intergenic
990836626 5:60028895-60028917 TAATCTGACTGGAGGGATTGAGG - Intronic
991238967 5:64434359-64434381 CAATGTGACTGGAAGAAAACCGG + Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
993118025 5:83741006-83741028 AAATGTGACTCGGGGGTAGGGGG + Intergenic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
996739905 5:126789173-126789195 CACTGTGTCTGGCGGGAGGGAGG + Intronic
997454416 5:134006272-134006294 CACTGAGACTGGTGGGCAGGGGG + Intergenic
997822672 5:137079853-137079875 AAATGTCACTGGAGCTAAGGGGG - Intronic
998068901 5:139181274-139181296 CACTGTGACTAGAGGCATGGTGG - Intronic
998101513 5:139439105-139439127 CAAGGTGACTGGAGGGCCCGTGG - Intronic
999479235 5:151930367-151930389 CAGTGTCATTGGAAGGAAGGAGG + Intergenic
999894011 5:156009060-156009082 CAGAGTGACTGGAGCGAAGGAGG + Intronic
1000537309 5:162494454-162494476 CACTGTAAATGGAGGGAGGGAGG + Intergenic
1001854119 5:174995866-174995888 CACTGTCACAGGAGGGAGGGAGG + Intergenic
1001866632 5:175111754-175111776 CCCTGTGACTGGAGGGAATGTGG + Intergenic
1002978315 6:2109180-2109202 CACTGGGACTGAAGTGAAGGAGG + Intronic
1006920132 6:37622362-37622384 CATTTCAACTGGAGGGAAGGAGG - Intergenic
1007155113 6:39735296-39735318 CAGTTTGATTGGAGGGAAAGGGG - Intergenic
1007599253 6:43071616-43071638 CAAAGTGAGTGGGGGGAAGGGGG + Exonic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1009158870 6:60257258-60257280 CAGTGTTACTGCCGGGAAGGAGG + Intergenic
1009194691 6:60669604-60669626 CAATGTGAATGGAAGTGAGGAGG + Intergenic
1010659565 6:78554458-78554480 CAAAATGGCTGGAGGGATGGGGG + Intergenic
1012305903 6:97656823-97656845 CTATGTAACAGGAGGGAAGGAGG + Intergenic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1014087429 6:117363543-117363565 CAATGTGATTGGAATGAGGGAGG - Intronic
1014715458 6:124859954-124859976 CAGTATGACTGGAGAGAATGTGG - Intergenic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1015579046 6:134703521-134703543 TAAGGTGAGTGGTGGGAAGGAGG + Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1016838242 6:148501151-148501173 AAATGGCAATGGAGGGAAGGTGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018840612 6:167514123-167514145 CAGTGTGACTGGGGGGTGGGGGG + Intergenic
1018992275 6:168683234-168683256 CACTGTCTCTGGAGGGGAGGAGG - Intergenic
1019256412 7:55241-55263 TAATGTGACTGGAGGGAAAGTGG - Intergenic
1019278314 7:187641-187663 CAATGGGCCAGGAAGGAAGGAGG - Intergenic
1019410095 7:902962-902984 TGATGTGCCTGGAGGGAAAGGGG - Intronic
1020250087 7:6460548-6460570 CTATGTAACTGGAGGCAACGAGG + Intronic
1021649863 7:22822634-22822656 GAAAGTGACTGGAGGGAAGAGGG - Intronic
1022415965 7:30177287-30177309 CACTGCCACTGCAGGGAAGGAGG + Intergenic
1022509464 7:30925942-30925964 AAATGTGAGTGGAGGGAGGGAGG - Intergenic
1022873753 7:34506629-34506651 CCATGTGACTGAAGCCAAGGAGG + Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023393608 7:39732892-39732914 CAGTGTGCATGGCGGGAAGGAGG - Intergenic
1024229738 7:47354943-47354965 CCCAGTGTCTGGAGGGAAGGAGG - Intronic
1027883652 7:83874693-83874715 AAATGTACCTTGAGGGAAGGGGG - Intergenic
1027991522 7:85369064-85369086 CATTGAGAGTGGATGGAAGGAGG - Intergenic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1033156575 7:138961989-138962011 CACTGAGACAGGTGGGAAGGGGG - Intronic
1033239247 7:139663564-139663586 AAAGGTAACTGGTGGGAAGGAGG + Intronic
1035615454 8:996888-996910 CAGTGTGACTTGTGGGAAGGTGG - Intergenic
1036776157 8:11614209-11614231 CAACGTCTCAGGAGGGAAGGTGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037826350 8:22162815-22162837 CAAGGGGAGTGGAGGGGAGGAGG + Intronic
1038259322 8:25979361-25979383 CAATGTGACTCGAGGGCCGGGGG - Intronic
1039296585 8:36162696-36162718 CCAGGAAACTGGAGGGAAGGAGG + Intergenic
1039822777 8:41148311-41148333 TAATGTGACTGGAGCTCAGGGGG - Intergenic
1040732039 8:50459673-50459695 CACTGAGGCAGGAGGGAAGGAGG - Intronic
1041929054 8:63267285-63267307 CAATCTGGTGGGAGGGAAGGGGG + Intergenic
1041944264 8:63424180-63424202 CACTGGGACTGGTTGGAAGGTGG + Intergenic
1042318785 8:67452905-67452927 CAATGTGGCTGGAGCCAAGTGGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1042938327 8:74082771-74082793 AAATATGACTGGAGGGCAGAAGG + Intergenic
1043638342 8:82414830-82414852 TAATGTGAGTAGAGGGAGGGAGG - Intergenic
1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG + Intergenic
1044322199 8:90815297-90815319 CAATCTCACTGGAGGGATTGAGG - Intronic
1046025755 8:108721584-108721606 CAAAGTGACTGGAGTGAGGATGG - Intronic
1046260664 8:111763529-111763551 CAATGTCACTGAAGGGGAAGGGG + Intergenic
1046606693 8:116379573-116379595 CAATGTGATTGGAATGAAAGAGG - Intergenic
1046816955 8:118595800-118595822 CAATCTTACTGTGGGGAAGGAGG - Intronic
1046856543 8:119038871-119038893 TAATGTGACTGGAGCCAAGTGGG - Intronic
1047011026 8:120672908-120672930 GAAGGAGACTGGAGGGCAGGAGG + Intronic
1047662718 8:127055065-127055087 CTATGTGACTGCAGGCAAGGAGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048383798 8:133892611-133892633 CCACGTGACTGAAAGGAAGGAGG - Intergenic
1048456902 8:134586734-134586756 CACTGAGACAGGAGTGAAGGGGG - Intronic
1048979884 8:139697538-139697560 CATTGTGAATGGAGAGATGGAGG + Intronic
1049285190 8:141770969-141770991 CATTGTGACTGCGGGGAGGGTGG - Intergenic
1049529492 8:143147277-143147299 GAATGTGTTTGGAGAGAAGGGGG + Intergenic
1050028113 9:1356787-1356809 CACTGTGACTGGAGGGCTGGGGG - Intergenic
1050503924 9:6327990-6328012 AAATGTGAGTGGAGGTAGGGCGG + Intergenic
1050544699 9:6700090-6700112 CAATCTTAGTGGAGGGATGGAGG + Intergenic
1050581443 9:7061636-7061658 CAATGAGGCAGGAGGGCAGGTGG + Intronic
1050620805 9:7450070-7450092 CCCAGTGACTGGCGGGAAGGGGG + Intergenic
1050639003 9:7645500-7645522 CAACTTGACTGGATTGAAGGAGG + Intergenic
1053006753 9:34609939-34609961 CAAGGAAGCTGGAGGGAAGGAGG + Intergenic
1055305768 9:74927680-74927702 ACTTGTAACTGGAGGGAAGGAGG - Intergenic
1056348509 9:85723691-85723713 CAATGGGACTGGTTGGACGGTGG - Intronic
1056460403 9:86804464-86804486 AAATGTGACTGAAGGGAAGTTGG - Intergenic
1058672879 9:107375485-107375507 CAACGTTCTTGGAGGGAAGGGGG + Intergenic
1058923146 9:109637403-109637425 GGATGTGACTGGGGGCAAGGAGG + Intergenic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1060329970 9:122659123-122659145 CCTAGTGGCTGGAGGGAAGGAGG + Intergenic
1060580454 9:124741141-124741163 GAATGTGACTGGCGTGAATGAGG + Intronic
1060828885 9:126701712-126701734 CAAGGTGACTGGATGGAAGCAGG + Intergenic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062051350 9:134448678-134448700 CAGTGTCACTGGAGGGCATGTGG + Intergenic
1062453531 9:136625336-136625358 GAATGTGGCTGGCGGGAACGGGG + Intergenic
1186169054 X:6858033-6858055 CTATGTGATTGGAGGGTTGGGGG + Intergenic
1186312667 X:8337648-8337670 CAATGTGTCTGCAGGGATGCAGG + Intergenic
1187274528 X:17806175-17806197 GATAGTGACTGGAGAGAAGGTGG + Intronic
1187475319 X:19605584-19605606 CCAAGTGAGTGGAGGCAAGGGGG - Intronic
1188153094 X:26703750-26703772 GTATGTGAGTGGAGGGAGGGAGG + Intergenic
1188781514 X:34292257-34292279 CAATGTCACTGTATGGAAGTGGG - Intergenic
1188970788 X:36613095-36613117 CAATGAGACTGGATAGAAGAGGG + Intergenic
1189451650 X:41138583-41138605 CAATGTCCCAGGAGGGTAGGAGG - Intronic
1190385380 X:49879041-49879063 CATTGAGGCTGGCGGGAAGGGGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192478632 X:71465872-71465894 GAATGGGATTGGAGGGGAGGGGG + Exonic
1193336786 X:80299126-80299148 CAATTTCAGTGGAGTGAAGGAGG - Intergenic
1194488992 X:94523428-94523450 CAATTTGATTGGATTGAAGGAGG - Intergenic
1195139991 X:101949756-101949778 AAGTGTTACTGGAGGGATGGGGG + Intergenic
1195548181 X:106137354-106137376 GAAGGTGGCTGGAGGGCAGGTGG - Intergenic
1198416578 X:136426083-136426105 CACTGTAACAGGAAGGAAGGTGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1200119890 X:153785197-153785219 CCATGTGGCTGCAGGGAGGGTGG + Intronic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic