ID: 1078357973

View in Genome Browser
Species Human (GRCh38)
Location 11:10647031-10647053
Sequence CTGAGGGGCTGGCAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 903
Summary {0: 1, 1: 1, 2: 9, 3: 102, 4: 790}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078357964_1078357973 -5 Left 1078357964 11:10647013-10647035 CCCCACGAGCTTGTGCTCCTGAG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG 0: 1
1: 1
2: 9
3: 102
4: 790
1078357965_1078357973 -6 Left 1078357965 11:10647014-10647036 CCCACGAGCTTGTGCTCCTGAGG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG 0: 1
1: 1
2: 9
3: 102
4: 790
1078357967_1078357973 -7 Left 1078357967 11:10647015-10647037 CCACGAGCTTGTGCTCCTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG 0: 1
1: 1
2: 9
3: 102
4: 790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078357973 Original CRISPR CTGAGGGGCTGGCAGGCAGA AGG Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183791 1:1323968-1323990 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183798 1:1323984-1324006 CTGAGGGGCTGGGGGACTGAGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183854 1:1324128-1324150 CTGAGGGGCTGGGGGGCTGGGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900214730 1:1475376-1475398 CAGAGGGGCTACCAGGCAGAGGG - Intronic
900221940 1:1513726-1513748 CAGAGGGGCTACCAGGCAGAGGG - Intronic
900398222 1:2462025-2462047 CAGAGGGGGTGTCAGGCAGAGGG - Intronic
900398262 1:2462164-2462186 TGGAGGGGGTGTCAGGCAGAGGG - Intronic
900398305 1:2462297-2462319 CAGAGGGGGTGTCAGGCAGAGGG - Intronic
900398314 1:2462328-2462350 CAGAGGGGGTGTCAGGCAGAGGG - Intronic
900398319 1:2462344-2462366 CAGAGGGGCTGTCAGGCAGAGGG - Intronic
900459917 1:2798126-2798148 CTGAGAGGCTGGGAGGCTGGGGG - Intronic
900459932 1:2798175-2798197 CTGAGAGGCTGGGAGGCTGGGGG - Intronic
900459983 1:2798311-2798333 CTGAGAGGCTGGGAGGCTGGGGG - Intronic
900460030 1:2798455-2798477 CTGAGAGGCTGGGAGGCTGGGGG - Intronic
900460072 1:2798591-2798613 CTGAGAGGCTGGGAGGCTGGGGG - Intronic
900460136 1:2798783-2798805 CTGAGAGGCTGGGAGGCTGGGGG - Intronic
900460149 1:2798823-2798845 CTGAGAGGCTGGGAGGCTGGTGG - Intronic
900460167 1:2798887-2798909 CTGAGAGGCTGGGAGGCTGGGGG - Intronic
900460179 1:2798927-2798949 CTGAGAGGCTGGGAGGCTGGGGG - Intronic
900605614 1:3522363-3522385 CTGAGGGGGTGACAGCCAGAGGG + Intronic
900763768 1:4489706-4489728 CTGGGTGGCTGGAAGGCAGGGGG + Intergenic
900930721 1:5735303-5735325 CTGCCGGGCTGGCAGGCATAGGG - Intergenic
901481597 1:9529048-9529070 CAGAGGGGCAGGCCTGCAGAAGG - Intergenic
901643193 1:10703412-10703434 CTGAGGGGCAAGCAGGCTGAGGG - Intronic
901643537 1:10704974-10704996 CTAAGAGGCTGGCAGGGAGAAGG - Intronic
901770663 1:11528958-11528980 CTCAGGGGAGGACAGGCAGAGGG - Intronic
902126142 1:14213311-14213333 CGGAGGGGATGGGAGGAAGAGGG - Intergenic
902154096 1:14469658-14469680 CTCATGGGCAGGAAGGCAGATGG + Intergenic
902228648 1:15013230-15013252 ATGAGGGTCTGGCATACAGAAGG - Intronic
902399557 1:16150590-16150612 CAGAAGGGCTGACAGTCAGAGGG - Intronic
902402612 1:16166403-16166425 TGGATGGGCTGGCAGACAGATGG - Intergenic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
902768745 1:18633477-18633499 CTGCGAGGCTGGTAGGCAGATGG - Intronic
902775360 1:18671124-18671146 CTGTGGGGCAGGAAGGCAGCAGG + Intronic
902842552 1:19084432-19084454 CTGAGGGGATCTCGGGCAGAGGG + Intronic
902848678 1:19134613-19134635 GTGAGGTCCTGGCAGCCAGAAGG - Intronic
902876639 1:19344495-19344517 CTGCAGGGCTGGCAGGTGGAGGG - Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
902899920 1:19507766-19507788 CTTAGAGGCTGGCAGGCTGAGGG - Intergenic
902975376 1:20084628-20084650 CTGAGGGCCCTGGAGGCAGAGGG - Intronic
903066421 1:20702217-20702239 CTGAGGAGCTGGGAGGGAGCTGG + Intronic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903162764 1:21501151-21501173 CTGAGGTACAGGCAGGAAGATGG + Intergenic
903224112 1:21885221-21885243 CCGAGGGGCTAGGAGGGAGAAGG + Intronic
903326309 1:22570824-22570846 CTGATGGGCTGGGAGGTAAAGGG - Intronic
903648410 1:24908750-24908772 CTGGGATGCTGGGAGGCAGAGGG - Intronic
903661450 1:24981300-24981322 CTGAGGGTCTGGAAGGCATCAGG + Intergenic
903845954 1:26280121-26280143 CAGACGGGCCGGCGGGCAGAGGG - Exonic
904253548 1:29240642-29240664 GGGAGGGGCTGGCAGGCAGGAGG - Intronic
904311524 1:29632628-29632650 CTGAGGGGCCGGGAGGCTGGGGG - Intergenic
904311549 1:29632693-29632715 CTGAGTGGCTGGGAGGCTGGGGG - Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904562295 1:31406904-31406926 ATGCAGGGCTGGCAGGCAGTAGG + Intergenic
904615640 1:31748143-31748165 TTGTGGGGCTGGCCAGCAGATGG - Intronic
904774627 1:32899201-32899223 GTGAGGGGCTGGCAGGGCCAGGG - Intronic
904790770 1:33018993-33019015 CTGGGGGGCAGGAAGGTAGAAGG - Intronic
904896895 1:33824380-33824402 CTCAGGGACTGGATGGCAGAGGG - Intronic
904971386 1:34421846-34421868 CAGAAGGGCTGACAGGCAGATGG + Intergenic
905124404 1:35707255-35707277 GAGAGGGGCTGGGAGGCAGATGG + Intergenic
905482373 1:38270516-38270538 CAGGGGGACTGCCAGGCAGAGGG - Intergenic
905776190 1:40668832-40668854 TGGAGGGGCTGGCGGGCAGGAGG - Intergenic
906329940 1:44876457-44876479 CGGGGCGGCTGCCAGGCAGAGGG - Intronic
906519581 1:46459167-46459189 CTGAGGAGCTGTCATGCTGACGG + Intergenic
906640139 1:47436894-47436916 CTGAGGGGGTGTCGGGCAGGGGG + Exonic
906724888 1:48037014-48037036 CTCAGAGACTGGCAGTCAGAGGG - Intergenic
906791399 1:48661324-48661346 CACAGGGCCTGCCAGGCAGAGGG + Intronic
907046985 1:51305455-51305477 GGGAGGGGCTTCCAGGCAGAGGG - Intronic
907272334 1:53298342-53298364 CTGAGGGGCTGGGAGGAGGTGGG + Intronic
907313719 1:53554404-53554426 CTGAGGTCATGGCAGGCAGTTGG + Intronic
907410175 1:54278372-54278394 GTTAAGGGCTGGCAGGGAGATGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907476552 1:54709826-54709848 ATGAGGGGATGCCAAGCAGAGGG + Intronic
907520667 1:55021502-55021524 CTGAGAGGCTGGCAGGAAAAAGG + Intergenic
907809241 1:57852025-57852047 CTGAGGGGGTCTCAGGCACAAGG + Intronic
907823942 1:57997497-57997519 CTGAGGGGCTATAAGGCAGAGGG - Intronic
909039004 1:70628314-70628336 CTGATGGGGTGGCAGGTAGCTGG - Intergenic
909564984 1:77044189-77044211 TTCAGGGGCTGGAAGGCAGGGGG - Exonic
909898964 1:81109260-81109282 CTGAAGGGCTGGCAGGCAGAGGG + Intergenic
910367973 1:86486928-86486950 GAAAGGGGCTGGCAGGCATAAGG + Intronic
910703260 1:90100114-90100136 CTGAGTGGCTGGGAGGAAAAGGG + Intergenic
910763056 1:90754083-90754105 GGAAGTGGCTGGCAGGCAGATGG + Intergenic
910777558 1:90891904-90891926 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
911533583 1:99075091-99075113 CTGTGGGGCGGCCTGGCAGAGGG - Intergenic
912431102 1:109628897-109628919 CAGAGGGGTTGGCAGGGACAAGG - Intronic
912775765 1:112505576-112505598 TTGTGGGGCTGCCAGGCAGAGGG - Intronic
912799649 1:112712867-112712889 CGGAGTGGTTGGGAGGCAGAGGG + Exonic
912804905 1:112748043-112748065 CTGAGGGGCTGGCACGACGGTGG - Intergenic
912844045 1:113063661-113063683 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
913112890 1:115671856-115671878 CTGTGGGGAAGGCAGCCAGAGGG + Intronic
914005615 1:143729857-143729879 CTGAGCGGCAGAAAGGCAGACGG - Intergenic
914098081 1:144561103-144561125 CTGAGCGGCAGAAAGGCAGACGG - Intergenic
914267759 1:146052521-146052543 CTGAGCGGCAGAAAGGCAGACGG - Intergenic
914300901 1:146376512-146376534 CTGAGCGGCAGAAAGGCAGACGG + Intergenic
914355094 1:146877939-146877961 CAGAGGGGCTGGAAGGGTGAAGG - Intergenic
915431819 1:155872599-155872621 TTGGGGGGCAGGCAAGCAGAAGG - Intronic
917081382 1:171259891-171259913 CTCAGGAGCTGTCAGGTAGATGG + Intronic
917968717 1:180194159-180194181 CTGTGGGGCTGGCAGCCTGAAGG + Intronic
918040142 1:180908976-180908998 CCGAGGGGCTGCCAGTCACAGGG + Intergenic
918812497 1:189139858-189139880 CGGGGCGGCTGCCAGGCAGAGGG + Intergenic
918917966 1:190669912-190669934 CTGAGGTGCTTGAAGGCAAAGGG - Intergenic
918950133 1:191126100-191126122 AGGAGGGGCTGGCAGTCAGGAGG - Intergenic
919131451 1:193455997-193456019 CTGAGTGGCAGGCAGGCAAGAGG + Intergenic
919872032 1:201829179-201829201 CCGCGGGGCTGGCGGGCTGAGGG + Exonic
920397826 1:205659588-205659610 CTTAGGGCCTGGCAGGAAGCTGG + Exonic
921162977 1:212486112-212486134 CTCAGCGGCTGGCTGACAGATGG + Intergenic
921190232 1:212701179-212701201 CTGAGAGGCGGGGAGGAAGACGG + Intergenic
921254755 1:213329362-213329384 ATGTGGAGCTGGCAGGGAGAAGG + Intergenic
921925243 1:220705703-220705725 ACCAGGGGCTGGCAGGGAGAGGG + Intergenic
922067437 1:222157898-222157920 CTGAGGGCCTGGCAGGCAAAGGG - Intergenic
922790523 1:228308482-228308504 CTGGGGGCCTGGCAGGGAGGTGG + Intronic
922799118 1:228356320-228356342 GTAAGGTGCTGGCAGTCAGAGGG - Intronic
922947147 1:229526381-229526403 CTGAGTGGAAGGCAGGCAGCTGG - Intronic
923336709 1:232977238-232977260 CTGGGGGGCAGGCAGGAACAGGG - Intronic
924796720 1:247297869-247297891 GTGAGGGGCTGGAAGCCACAGGG - Exonic
924925607 1:248676900-248676922 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
1063221802 10:3975717-3975739 CTGAGGGGGTGTCAGGCTGCTGG + Intergenic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1063503083 10:6572134-6572156 CTCAGGGGCTAGAAGGAAGAGGG - Intronic
1063510735 10:6642843-6642865 CTGGAGGGCTGGGAGGGAGAGGG + Intergenic
1063942722 10:11147115-11147137 CAGAGAGCCTGGCAGGCACAAGG - Intronic
1065055351 10:21837703-21837725 CGGGGCGGCTGCCAGGCAGAGGG - Intronic
1065093453 10:22258667-22258689 CTGAGGGGCAGGTGGTCAGATGG - Intergenic
1065117611 10:22497735-22497757 GTCAGGGGCTGGGAGGCAGGTGG + Intergenic
1066153581 10:32650920-32650942 GGGAGGGGCTGGCAGGCAGGTGG + Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067789697 10:49278397-49278419 CAGAGTGCCTGGAAGGCAGATGG - Intergenic
1068764222 10:60745533-60745555 CAGAGGAGCTGACAGGCAGTAGG - Intergenic
1069157957 10:65053581-65053603 GTGAGGGGCTGAAAGGCTGAAGG - Intergenic
1069373466 10:67770514-67770536 CTGAAGGGGTGGGAAGCAGAGGG + Intergenic
1069618314 10:69820440-69820462 CTGGGGGCCTGGCACCCAGAAGG - Intronic
1069732968 10:70631178-70631200 CTGGGCGGTTGCCAGGCAGAGGG - Intergenic
1069732989 10:70631258-70631280 CTGGGCGGCTGCCGGGCAGAGGG - Intergenic
1069903927 10:71721247-71721269 CTTAGGAGCTGGCAGGTGGAGGG - Intronic
1070148413 10:73791048-73791070 CTGAGGGGCCGTGAGCCAGAGGG + Exonic
1070425932 10:76287213-76287235 CTGAGAGTGGGGCAGGCAGATGG - Intronic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070761249 10:79025638-79025660 CAGAGAGGCTGGCAGGCAGGCGG - Intergenic
1070803559 10:79257267-79257289 CTCAGAGGCTGGCAGACAGGGGG - Intronic
1070809239 10:79289293-79289315 GTGAAGGGCTGGGAGGTAGAGGG + Intronic
1070824934 10:79385564-79385586 CAGAGTGGGTGGGAGGCAGAGGG + Exonic
1071081544 10:81818315-81818337 GGGAGGGGCTGGAAGGCAGGAGG - Intergenic
1072533623 10:96342841-96342863 GTGAGGAACAGGCAGGCAGAAGG + Intergenic
1072611220 10:97018738-97018760 CTGAGGGTCTGGCTGGCTGTTGG - Intronic
1072806993 10:98429946-98429968 GTGAAGCGCTGGGAGGCAGAAGG - Intronic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073100833 10:101005792-101005814 CTCTGGGGGTGGCAGGCTGAGGG - Intronic
1073291008 10:102413269-102413291 CTGAGAGGGTAGCTGGCAGAGGG + Intronic
1073434936 10:103510639-103510661 CTGAGGGGCTGAGACCCAGAGGG + Intronic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075654067 10:124149796-124149818 CTGAAGGGCTGGCAAGAGGAGGG + Intergenic
1075684616 10:124354772-124354794 CTGAGGAGAAGGCAGTCAGAGGG + Intergenic
1075725390 10:124608262-124608284 GTGGGGGGCAGACAGGCAGACGG - Intronic
1075806065 10:125189639-125189661 CTGGGGGGCTTCCAGCCAGAGGG + Intergenic
1075828776 10:125384986-125385008 TGGAGAGGCTGGCAGACAGAGGG + Intergenic
1076106004 10:127824170-127824192 CAGAGGGGCTGGAAGGCATGGGG + Intergenic
1076328529 10:129647014-129647036 CTGAGCGGCTGGGAGGAAAATGG - Intronic
1076482777 10:130795738-130795760 ATGAGGGGCTGGCAGGACGGAGG + Intergenic
1076660685 10:132054232-132054254 CGGAGGAGCTGGCAGGCTCAGGG + Intergenic
1076763181 10:132615830-132615852 CTGAGGGGCTGGGAGGCCCCAGG + Intronic
1077110567 11:860373-860395 CTGGCTGGCTGGCAGGCAGGAGG - Intronic
1077116145 11:885490-885512 CGGTGGGGCTGGCAGGCATCAGG - Intronic
1077287443 11:1773864-1773886 GGGAGGGCCTGGCAGGCACATGG + Intergenic
1077363635 11:2152396-2152418 CCGAGGGGCTGGCAGGGCCAAGG + Intronic
1077930060 11:6721539-6721561 CTGAGGGACTTGCTGACAGAAGG - Intergenic
1077985701 11:7348992-7349014 CTGCTGGGCTGTCAGGCAGAGGG + Intronic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078840699 11:15073736-15073758 CGGAGAGGCAGACAGGCAGATGG - Intronic
1079020568 11:16907037-16907059 CGGAGTGGCTGCCGGGCAGAGGG - Intronic
1080845693 11:36024806-36024828 TTGAGGGGCGAGGAGGCAGATGG + Intronic
1080986811 11:37477517-37477539 GTCTGGGGCTGACAGGCAGAGGG - Intergenic
1081670397 11:44939109-44939131 CACAGGGGCTGGCACGCAGTAGG - Exonic
1082771005 11:57207344-57207366 CTAAGGGGCTGGCAGGCAGGCGG + Intergenic
1082799275 11:57402409-57402431 CTGAGGGGCTGGCAGGAAAAAGG + Intronic
1083234958 11:61345382-61345404 CTGAAGGGCTGACAGGGAGGTGG + Intronic
1083317096 11:61822535-61822557 CTGAGGGCCTGGGAGGAAGAAGG - Intronic
1083474462 11:62906999-62907021 CTGAGGTCCTGGGAGGCAGAAGG - Intergenic
1083712116 11:64555892-64555914 CTGAGGGGCAGGAAGGCAGAAGG + Exonic
1083724257 11:64620094-64620116 CTGAGGGGCTGGGAACCAAAAGG + Intronic
1083776311 11:64895824-64895846 CAGAGGATCTGGCAGACAGAAGG - Intronic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1083885959 11:65573638-65573660 CTGAAGGGCTGGGGGGCAGGGGG + Exonic
1084113021 11:67025584-67025606 CTGGAGGTCTGCCAGGCAGAAGG - Intronic
1084329923 11:68424268-68424290 CTGGGGGGCTGGCATGAAGACGG + Intronic
1084456189 11:69269413-69269435 CTGACTGGCTGGCAGCCAGCAGG - Intergenic
1084675265 11:70630327-70630349 CTGTGAGGGTGGCAGACAGAAGG + Intronic
1084960340 11:72713104-72713126 CTCAGGGTCTGACAGGCAGCTGG + Intronic
1085463619 11:76709863-76709885 CAGAGGGCCTGGCATGCAGTGGG - Intergenic
1086523376 11:87697383-87697405 GGGATGGGCTGACAGGCAGAAGG + Intergenic
1086752541 11:90515567-90515589 GTGGGGGGCTGGCTGGCAGGTGG + Intergenic
1088399340 11:109406153-109406175 CTCAGAGGCTGGCAGGGACATGG - Intergenic
1089116109 11:116096466-116096488 GTGAGGAGCTGGCAGCCAGCGGG + Intergenic
1089497604 11:118915699-118915721 CCAAGGGGCAGGCAGGGAGAAGG - Intronic
1089631183 11:119785389-119785411 GTGAGGAGCTGCCAGACAGATGG - Intergenic
1089685589 11:120144684-120144706 CTGAGGGACTGGCTGGCTGTGGG + Intronic
1090040490 11:123286576-123286598 AGGAGGGGGTGGCAAGCAGAGGG - Intergenic
1090207521 11:124894088-124894110 TTGAGGGCCTGGCAGGCAAGGGG + Intronic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1090322890 11:125862959-125862981 CGGAGTGGTTGCCAGGCAGAGGG - Intergenic
1090456601 11:126855643-126855665 GTGAGGCTCTGGCAGCCAGATGG + Intronic
1090596544 11:128326977-128326999 CTGAGGGGCAGCCGGGCAGAAGG - Intergenic
1090716885 11:129438924-129438946 CTGAGGGGTTGGCACACACAAGG + Intronic
1090935903 11:131342060-131342082 AAGAGGTGCAGGCAGGCAGAGGG + Intergenic
1091088366 11:132745883-132745905 CTTAGAGGCTGGGAGGCAGGAGG - Intronic
1091305344 11:134532685-134532707 CTGAGGGGCAGGACGGGAGATGG + Intergenic
1091400212 12:176736-176758 CAGATGGGCTGGCAGCCACAGGG - Exonic
1091450631 12:570201-570223 CCGAGGGGACGGCGGGCAGAAGG + Intronic
1091583213 12:1801000-1801022 CTGGCTGGCTGGCTGGCAGAGGG + Intronic
1091597295 12:1886648-1886670 CTGAGGGGCTGGCAGCAGAAAGG + Intronic
1091758847 12:3074195-3074217 CTGAGGGGCTGACAGTTGGAAGG - Intergenic
1091828661 12:3534018-3534040 CAGAGGGGCTGGCACGAAGGTGG + Intronic
1092223469 12:6731075-6731097 CTAAGAGGCAGGCAGGCAGCTGG - Exonic
1092255075 12:6922450-6922472 CAGATGGTCTGGCAGGCAAATGG - Intronic
1093612739 12:21182528-21182550 GGGAGGGACTGGCGGGCAGAAGG - Intronic
1093750419 12:22792639-22792661 CTGAGAGGGTGGCAGAAAGAGGG + Intergenic
1096044644 12:48551950-48551972 CGGGGTGGCTGCCAGGCAGAGGG - Intergenic
1096122531 12:49097551-49097573 CTGAGAGGGTGGGTGGCAGAGGG - Exonic
1096386680 12:51199060-51199082 CGGAAGGCCTGGCAGGCAGCAGG - Intronic
1096529259 12:52233097-52233119 CGGCGGGGCGGGCGGGCAGAGGG + Exonic
1096556994 12:52409784-52409806 CGGAGTGGCTGCCGGGCAGAGGG - Intergenic
1096747384 12:53737814-53737836 GTGAGGAGAGGGCAGGCAGAGGG - Intergenic
1096789858 12:54037926-54037948 CAGAGGGCCTGGCAGTTAGAGGG + Intronic
1096882588 12:54684871-54684893 GAGAGGGGCTGGCAGCCTGAGGG + Intergenic
1097166475 12:57088993-57089015 CTGCCGGGCTGGCGGGCGGAGGG - Exonic
1099049845 12:77768615-77768637 GTGGGGAGCTGCCAGGCAGAGGG + Intergenic
1099373412 12:81866092-81866114 GGGAGGGGCTGGCATGCAGAAGG + Intergenic
1100168677 12:91947652-91947674 TTGAGGGGCTGGGAGGAAGTAGG + Intergenic
1100884998 12:99059968-99059990 CTGCTGGCCTGGCAGGCCGATGG - Intronic
1101445734 12:104735735-104735757 CTGAGGGGCTGGCAGGGGCCAGG + Intronic
1101490907 12:105208443-105208465 CTGAGGGTCTGTGAGGGAGAGGG + Intronic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102574074 12:113844857-113844879 CTGAGACGCAGGCAGGCAGCTGG - Intronic
1102959858 12:117085407-117085429 GTGAGGGTCGGGAAGGCAGAAGG + Intronic
1103414066 12:120732429-120732451 CGGGGTGGCTGCCAGGCAGAGGG + Intronic
1103447255 12:121002234-121002256 CTGGGGGCCTGGCTGGCTGAGGG + Exonic
1103506313 12:121443980-121444002 AGGAGGGGCTGGGAGGCAAAGGG - Intronic
1103567777 12:121825469-121825491 CAGAGGGGCTGGCACACAGAGGG + Intronic
1103608699 12:122107689-122107711 CTGCAGAGCTGGCAGGCAGTTGG + Intronic
1103612484 12:122132410-122132432 GGAAGGGGCTGGCAGGCACAGGG + Intronic
1103765238 12:123275050-123275072 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765248 12:123275082-123275104 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765254 12:123275098-123275120 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765264 12:123275130-123275152 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765274 12:123275162-123275184 CTGAGGGGCTGGGGTGCTGAGGG + Intergenic
1103765289 12:123275218-123275240 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1103765292 12:123275226-123275248 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1103909774 12:124345824-124345846 CTGTGGGGCTGTGAGGCGGAAGG - Intronic
1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG + Intronic
1103961642 12:124612629-124612651 GGGAGGGGCTGGGAGTCAGAAGG - Intergenic
1104077517 12:125403276-125403298 CTGAGGGGCCACCAGCCAGAGGG - Intronic
1104252954 12:127113304-127113326 CCAAAGGGCTGGGAGGCAGAAGG + Intergenic
1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG + Intronic
1104574810 12:129957388-129957410 CTTAGAGGAAGGCAGGCAGATGG + Intergenic
1104664232 12:130635975-130635997 CTCGGAGGCTGGAAGGCAGAGGG - Intronic
1104861459 12:131926427-131926449 CGGGGCGGTTGGCAGGCAGAGGG + Intergenic
1104895129 12:132160285-132160307 CCTACTGGCTGGCAGGCAGACGG + Intergenic
1106224375 13:27774003-27774025 CTGAGGTGCTGGAAGGGAGCAGG + Intergenic
1109058548 13:57582704-57582726 ATTGGGGGCTGGCAGGCAGGAGG + Intergenic
1109463517 13:62695547-62695569 CTGTGGGGGTGGCAGGCATGAGG - Intergenic
1110871821 13:80461397-80461419 CTGAGAGACAGGAAGGCAGAAGG - Intergenic
1111693385 13:91592839-91592861 GGGAGGGGCTGGCAGGCAAGGGG + Intronic
1112395221 13:99023772-99023794 GTGAGGGGCTGACAGGCCAATGG - Intronic
1112773178 13:102814211-102814233 CTGATGTGATGGAAGGCAGAAGG + Intronic
1113455718 13:110447267-110447289 GTGTCGGGCTGGCAAGCAGAGGG - Intronic
1113923780 13:113929260-113929282 CTGAGGAGGTGGCAGACGGAAGG - Intergenic
1114165098 14:20212540-20212562 CGGGGTGGCTGCCAGGCAGAGGG - Intergenic
1114619609 14:24087418-24087440 AAGAGGGGCAGGCAGGCAAAGGG + Intronic
1114976834 14:28112322-28112344 CTAAGGATCTGGGAGGCAGATGG - Intergenic
1116231981 14:42229291-42229313 CTGAGGAGCTGACAGGCTGGAGG - Intergenic
1116697405 14:48194315-48194337 CTGAGGGGCGTTAAGGCAGAAGG - Intergenic
1117479507 14:56129005-56129027 TTGAGGGGCTGAGAGGCTGAGGG + Intronic
1117486646 14:56204556-56204578 CTGAAGTGCTGGCATTCAGAAGG + Intronic
1117943958 14:60998268-60998290 ATGCGGGGATGGCAGGCAGAAGG - Intronic
1118316712 14:64730232-64730254 CTGAGGAGCTGGCTGGGTGAGGG - Intronic
1118591199 14:67402560-67402582 GTGAGGGGCTGCCGGGGAGATGG - Intronic
1118599011 14:67458384-67458406 CTGCGGGTCTGGCAGGTAGTAGG - Intronic
1118729131 14:68654492-68654514 GTCAGTGCCTGGCAGGCAGATGG + Intronic
1119543784 14:75457405-75457427 CTGTGGGGCATGAAGGCAGAGGG + Intronic
1119658880 14:76436665-76436687 CTGATGGCCTGCCAGGCTGATGG + Intronic
1121096377 14:91220610-91220632 CCGTGTGGCTGGGAGGCAGATGG + Intronic
1121256574 14:92534703-92534725 CTGAGGGGCAGCCAGGCAGGGGG + Intronic
1121332454 14:93058150-93058172 CTGATGGGCTTGCAGGCCCAGGG - Intronic
1121410539 14:93745722-93745744 AGGAGGGGCTGGCAGGGGGATGG - Intronic
1121455923 14:94038827-94038849 CTGAGGGGATAGCAGCCTGAAGG + Intronic
1121616024 14:95314433-95314455 ATGCCGGGCTGGAAGGCAGACGG + Intronic
1122143006 14:99673753-99673775 CTGAGGGGGTGGCACGGAGGGGG + Intronic
1122269878 14:100564103-100564125 CTTAGGGGCTGGCCGGGAGCAGG + Intronic
1122693559 14:103542467-103542489 ATGAGGGGCTGGCAGGCCTGGGG - Intergenic
1122786390 14:104166122-104166144 CTGAGGGGCAGGGTGGCAGCGGG + Intronic
1122808375 14:104274023-104274045 CTCAGGGGCTGGGAGGGAGGTGG - Intergenic
1123215960 14:106809697-106809719 CTGTGGACCTGGCAGGCTGAGGG - Intergenic
1123456111 15:20427597-20427619 GGGAAGGGCTGGTAGGCAGAAGG + Intergenic
1123635458 15:22303240-22303262 GGGAAGGGCTGGTAGGCAGAAGG - Intergenic
1125157272 15:36602184-36602206 CTGATAGCCTGGCAGGCACAGGG - Intronic
1126335510 15:47582763-47582785 TTGAGAGGCTGGCAGGCTGAGGG - Intronic
1127838901 15:62812797-62812819 CCGAGGGGCGGGCGGGCAGATGG + Intronic
1128220717 15:65966655-65966677 CTTAGGGGCTCACAGGCTGATGG - Intronic
1128438069 15:67675435-67675457 CTGAGAGGATGGGAGACAGAGGG + Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1129252054 15:74314573-74314595 CTAGGGGGCTGGCAGGGGGAGGG - Intronic
1129320200 15:74770472-74770494 ATGGAGGGCTGGCAGGCAGAAGG + Intergenic
1129439975 15:75574343-75574365 TTGCGGGGCAGGCAGGCTGAGGG + Intronic
1129716732 15:77856623-77856645 CTGAGGAGGCGGCAGGGAGAAGG + Intergenic
1130110185 15:80957787-80957809 CTCAAAGGCTGTCAGGCAGAAGG + Intronic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1130888840 15:88116056-88116078 CAGAGAGGCTAGCAGGCAGTGGG - Intronic
1130946266 15:88552606-88552628 CGGGGCGGCTGGCGGGCAGAGGG + Intergenic
1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG + Intronic
1131343127 15:91621472-91621494 CTGGTGGGCAGGCAGGCAGAGGG + Intergenic
1131435193 15:92416503-92416525 CTGAGGGGCTGGGAAAGAGAAGG + Intronic
1131497193 15:92922804-92922826 CTGAGGGGCATGCTGGTAGAGGG - Intronic
1131696903 15:94887283-94887305 CAGAGAGGCTGACAGTCAGATGG - Intergenic
1132163315 15:99563386-99563408 CAAAGGGGCTGGCAGGCCGTGGG - Intergenic
1132623175 16:877805-877827 CTGAGGGACCCGCAGACAGACGG + Intronic
1132669209 16:1095838-1095860 CTCATGGGGAGGCAGGCAGAGGG - Intronic
1132805232 16:1772176-1772198 CTTAGGGGCTGTGAGGCAGTGGG - Exonic
1132895594 16:2228017-2228039 GAGAGGGGCTGGGAGGCAGAGGG - Intronic
1132992262 16:2802125-2802147 CGGAGTGGTTGCCAGGCAGAGGG + Intergenic
1132999243 16:2840872-2840894 CTGGGGTCCTGGGAGGCAGATGG + Intergenic
1133001458 16:2853558-2853580 CTCAGGGGCTGTCTGGAAGACGG - Intronic
1133018078 16:2954100-2954122 CAGAGGGGCTGGCAGGATGGGGG - Intergenic
1133343609 16:5055370-5055392 CTGGGGGGCAGGCCTGCAGAGGG - Intronic
1133815195 16:9192022-9192044 GTGAGGAGCTGGGATGCAGAGGG + Intergenic
1134311028 16:13075343-13075365 CAGAGAGGCTGGCTGGCAGGAGG + Intronic
1134353595 16:13460895-13460917 CTGAGCGGCTGGTTGGCAGAAGG - Intergenic
1134609800 16:15598927-15598949 CTGAGGGGACGGCAGGCACGAGG + Exonic
1135110141 16:19684264-19684286 CTGAGGGTCCGCCAGGCAGGAGG - Intronic
1136013106 16:27377439-27377461 GTGAAGGGCTGGCAGGGAGCAGG + Intergenic
1136016117 16:27402263-27402285 CTCAGGGAGAGGCAGGCAGAGGG - Exonic
1136186491 16:28591567-28591589 CTGTGGGGCAGGCAGACAGGAGG - Intronic
1136188976 16:28604291-28604313 CTGTGGGGCAGGCAGACAGGAGG - Intergenic
1136234214 16:28904390-28904412 CCGAGGGGCTTGCAGGGACAAGG + Exonic
1136548940 16:30971584-30971606 CTGGGGGGCGGGGAGGCTGAGGG - Exonic
1136873423 16:33828383-33828405 CTAAGGACCTGGCAGGCTGAGGG + Intergenic
1136910433 16:34140833-34140855 CGGTGGGGCGGGGAGGCAGAGGG + Intergenic
1137441692 16:48503803-48503825 CTGAGAGGCTGGCAGGGGGATGG + Intergenic
1138299149 16:55911890-55911912 CTATGGGGCTGCCAGGGAGAGGG + Intronic
1138353025 16:56356551-56356573 CTGGGCGGCCGGCAGGCAGCAGG - Intronic
1139513450 16:67440148-67440170 CTGAGGGGCTGCCTGGAGGATGG - Intronic
1139978922 16:70837590-70837612 CAGAGGGGCTGGAAGGGTGAAGG + Intronic
1140271189 16:73467833-73467855 CTGAGGAGCTGGAAGTCAGCAGG - Intergenic
1140767075 16:78169846-78169868 GTGAGGGCCTGGCAGGCATGAGG - Intronic
1141091254 16:81131863-81131885 CTGAGGTGGTTGCAGGGAGAGGG - Intergenic
1141430264 16:83967677-83967699 CAGATGGGCGGGCGGGCAGATGG + Intergenic
1141641272 16:85342970-85342992 AGGAGGGGGTGGCAGGCAGCAGG + Intergenic
1141660925 16:85441028-85441050 ACGAGGGGCTGGCGGGGAGATGG + Intergenic
1141760110 16:86022696-86022718 GTGAGGGGCTGGCTGGCTGCTGG + Intergenic
1141760583 16:86026240-86026262 CAGTGGGGGAGGCAGGCAGAGGG + Intergenic
1141774253 16:86111584-86111606 CTGAGGCACTGGGAGGGAGAGGG + Intergenic
1141924732 16:87160640-87160662 CTCAGGTGCTGGAATGCAGAAGG + Intronic
1142021429 16:87785319-87785341 CTGAGGGTGTCGCAGCCAGAAGG - Intergenic
1142224890 16:88872500-88872522 CGGAGGGGCCGGCATGCACATGG + Intergenic
1142260054 16:89038645-89038667 ATGAGGGGCCGGCGTGCAGAGGG - Intergenic
1142260060 16:89038678-89038700 ATGAGGGGCTGGCGTGCAGAGGG - Intergenic
1142401987 16:89863716-89863738 CTGAGGGGGTAGCAGGGACAGGG + Intronic
1203098752 16_KI270728v1_random:1287672-1287694 CTAAGGACCTGGCAGGCTGAGGG - Intergenic
1142589724 17:997411-997433 CTGAGGGCCTGGACGGCAGTGGG + Intronic
1142869137 17:2809226-2809248 CTGATGGGCAGGCAGGGAGCCGG + Intronic
1142927834 17:3256724-3256746 CTGAGAGGCGAGCAGGGAGATGG - Intergenic
1143112572 17:4560545-4560567 CGGAAAGGCTGGCAGGCAGGAGG - Exonic
1143289273 17:5816737-5816759 CTCAGGGCCTTGGAGGCAGAAGG + Intronic
1143379687 17:6488286-6488308 AGGAAGGGCTTGCAGGCAGAGGG - Intronic
1143543170 17:7581488-7581510 CAGAGGGCCTGGTAGGCGGATGG - Exonic
1144496612 17:15749832-15749854 CTGAGGGGCTGAAAGGCTGAGGG + Intergenic
1144496670 17:15750016-15750038 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1144496689 17:15750074-15750096 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1144606263 17:16667477-16667499 CTGAGGGGCTGAAAGGCTGAAGG + Intergenic
1144772644 17:17768583-17768605 GTGAGGGGCTGTCAGGGCGACGG + Intronic
1144794455 17:17881615-17881637 CTGTGGGCTTGACAGGCAGATGG - Intronic
1144813502 17:18017425-18017447 CTGAGGGGCAGGGAAGCAGGAGG + Intronic
1144904943 17:18634791-18634813 CTGAGGGGCTGAGGGGCTGAGGG - Intergenic
1146677652 17:34784629-34784651 CTGGGGTGCTGGCAGGGGGAAGG - Intergenic
1146722625 17:35133794-35133816 TTGGGGGGATGACAGGCAGATGG - Intronic
1146729501 17:35181872-35181894 CTGGGGGCCTGGCAGCCATAGGG + Intronic
1147187794 17:38722089-38722111 TGGGGGGGCTGGCAGGCAGTGGG + Exonic
1147912201 17:43862410-43862432 CTGAAGGGCTGGGATGCAGGTGG - Exonic
1148018052 17:44536456-44536478 CAGAGGGGCTGTCAGCCAGATGG + Intergenic
1148550824 17:48550121-48550143 CCGATGGGTTGGCAGGCAGATGG + Exonic
1148758298 17:49986068-49986090 GTCAGGGGCTGGGAGGCTGAGGG + Intergenic
1148773009 17:50077691-50077713 CTCAGGGGCTGGCACACAGTTGG - Intronic
1148913671 17:50956893-50956915 CTGAGGGGCTGGTAGGCTCTGGG + Intergenic
1150239794 17:63622473-63622495 CTGAGGGACTGGCGGGCGGGCGG + Exonic
1150280242 17:63925873-63925895 CTGGGGAGGGGGCAGGCAGAGGG + Intergenic
1150364914 17:64573649-64573671 CTGAGTGGCAGGTAGGCAGAAGG + Intronic
1150711172 17:67531987-67532009 CAGAGAGGCAGGAAGGCAGATGG + Intronic
1151021567 17:70623254-70623276 CTAAGTGGCTGGCTGGCACATGG + Intergenic
1151352038 17:73537511-73537533 CTGATGGAGAGGCAGGCAGAGGG + Intronic
1151480333 17:74366794-74366816 TTGAGGGGTAGGGAGGCAGAAGG + Intergenic
1151818575 17:76484381-76484403 CTGAAGGGCTCCCAGGGAGATGG - Intronic
1151826787 17:76528287-76528309 CTGAGCGGCTGGCAGGAAGCGGG - Exonic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1152251827 17:79216431-79216453 CTGGGGGGCAGGCAGGAAGGAGG + Intronic
1152456459 17:80419625-80419647 CAGAAGGGCTGACAAGCAGAAGG - Intronic
1152457766 17:80425953-80425975 CTGAGGGGCTGGCTGGGAACTGG - Intronic
1152686483 17:81696208-81696230 CTCTGGGGGAGGCAGGCAGAGGG - Intronic
1152698863 17:81809411-81809433 CAGACGGACAGGCAGGCAGACGG - Intronic
1152698868 17:81809439-81809461 CAGACAGGCAGGCAGGCAGACGG - Intronic
1152800617 17:82329119-82329141 CTGAGGACCTGGCTTGCAGACGG + Intronic
1152844874 17:82593564-82593586 CTGTGGGGCCGGGAGCCAGAAGG - Intronic
1153581959 18:6582475-6582497 GGGAGGGGCCGGCAGGCAGGTGG - Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1154174471 18:12076480-12076502 CCGAGGGGCTGGCAGGGCGGCGG - Intergenic
1157422903 18:47560898-47560920 CTGGGGGGCTGGCGGGCACTGGG - Intergenic
1157566428 18:48681744-48681766 GTGTGGGGCAGGCAGGCAGGTGG - Intronic
1157964542 18:52192984-52193006 CTGAGGAGCTGTAATGCAGAGGG + Intergenic
1158675254 18:59512611-59512633 CTGTGGTGCTGGCAGGCCCAGGG + Intronic
1158857406 18:61556657-61556679 ATGAGGGTCTGGGAGGCAGTAGG + Intergenic
1160323634 18:77919511-77919533 CTGATGGACGGGCAGGCAGATGG + Intergenic
1160535626 18:79589938-79589960 CTGAGGCCCTGGGAGGAAGAGGG - Intergenic
1160562871 18:79770565-79770587 GTGCGGGGCTGGGAGGCACAGGG + Intergenic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160774462 19:848639-848661 CCGAAGGGCTGCCAGGCAGGGGG + Intergenic
1161251813 19:3284884-3284906 CTGAGCTGCGGGCAGACAGAGGG - Exonic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161473766 19:4473574-4473596 TTGAGGGGCTGGGGGGCCGAGGG + Intronic
1161586716 19:5109666-5109688 CTGAGGGTCTGGGAGGCTCAGGG - Intronic
1161843506 19:6696546-6696568 CTGAGGGGCTGGCAGGGTAAGGG - Intronic
1161948720 19:7455187-7455209 CTCGGCGCCTGGCAGGCAGAAGG - Intronic
1162163846 19:8739450-8739472 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
1162418561 19:10552870-10552892 CTGAGGACCTGGCGGGAAGAGGG - Exonic
1162439203 19:10682352-10682374 CACTGTGGCTGGCAGGCAGAGGG + Intronic
1162955063 19:14092844-14092866 CTGAGGGGCTGGGGGGCTGTGGG + Exonic
1163129259 19:15262162-15262184 CTGGGAGGCAGGCAGGCAGTGGG + Intronic
1163293220 19:16394330-16394352 CCAGGGAGCTGGCAGGCAGATGG - Intronic
1163551374 19:17967792-17967814 CTGGAGGGCTGGCCAGCAGATGG + Intronic
1163579963 19:18132600-18132622 CAGAGGGTCTGGCATGCAGTAGG - Intronic
1163749740 19:19069302-19069324 GTGAGGTTCTGGCAGGCAAATGG + Intronic
1164244670 19:23419366-23419388 CGGGGTGGCTGCCAGGCAGAGGG - Intergenic
1164387275 19:27783677-27783699 CTGAGGGACTGGCTGTCAGGGGG + Intergenic
1164671854 19:30076870-30076892 CCCAGGGGCTGGCAGGCCAAGGG - Intergenic
1164678747 19:30120135-30120157 CTGAGGGGCTGCTAAGCTGATGG + Intergenic
1165059784 19:33199539-33199561 CAGAGGGGATGGGAGGCAGGAGG - Intronic
1165093101 19:33396766-33396788 CTCTGGGGCTTGCAGGCGGAGGG + Intronic
1165291472 19:34889579-34889601 CCGAGGGACTGGAATGCAGAGGG - Intergenic
1165386117 19:35511594-35511616 CTGAGGGGCAGGAAGGGAGCAGG + Intronic
1165766741 19:38356383-38356405 CGGAGGGGCTGGTGGGCATAAGG + Intronic
1165838860 19:38774900-38774922 CTGGGGGCCTGGGACGCAGAGGG - Intergenic
1165850033 19:38844542-38844564 CAAAGTGGCTGGCAAGCAGACGG - Intronic
1165937871 19:39400137-39400159 GGGAGGTGCAGGCAGGCAGATGG + Exonic
1166191609 19:41180304-41180326 CTGGGTGGCTGCCGGGCAGAGGG - Intergenic
1166421461 19:42639725-42639747 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
1166793288 19:45410615-45410637 GTTAGGGGCTGGCAGGGAGATGG - Exonic
1167736663 19:51298579-51298601 CTGTAGGGCAGGCAGGCAGGAGG + Intergenic
1167897544 19:52593681-52593703 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
1168340057 19:55617567-55617589 CTCAGGGCCTGGCAGGCAGGAGG - Exonic
1202709483 1_KI270714v1_random:9706-9728 CTGAGCGGCAGAAAGGCAGACGG + Intergenic
925286175 2:2717071-2717093 CTGAGTGACAGGCAGGCACAGGG + Intergenic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
925685522 2:6468671-6468693 CTTAGTGGCTGGCAAGCAAAAGG + Intergenic
925817986 2:7771981-7772003 CTGAGAGGCTGCCAGGCAGGTGG + Intergenic
925919686 2:8630537-8630559 CTGAGGGGCGGGGGGGCAGGGGG + Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926325374 2:11780626-11780648 ATGAGGGCCTGGGAGGCAGCAGG + Intronic
926447762 2:12965194-12965216 GTGAAGGGCTGGGAGGGAGAGGG - Intergenic
926479759 2:13377569-13377591 GGGAGGGGCTTGTAGGCAGAAGG - Intergenic
926861865 2:17318322-17318344 GTGAGGGGTGGCCAGGCAGAAGG - Intergenic
926911327 2:17854007-17854029 CTGAGGGGAGGGGAGGCGGAGGG + Intergenic
927144925 2:20157295-20157317 CTGAGAGGTTGGCAGGGTGAGGG + Intergenic
927554224 2:24021326-24021348 CTCAGGGCCTGGCATGCGGAAGG + Intronic
927810830 2:26179469-26179491 CTGTGGGGCAGGCATGGAGAAGG + Intronic
927946236 2:27136979-27137001 CTGAAGGGCTGGCTGGCCGGAGG - Exonic
928622809 2:33108221-33108243 CTGGGGGGCTGTGGGGCAGAGGG + Intronic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
929765090 2:44837620-44837642 CTGAGGGGCTGTCTGGGAGGTGG + Intergenic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
929919147 2:46160301-46160323 CTGAGAATCTGGAAGGCAGAAGG - Intronic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
931717857 2:65043302-65043324 CTCAGGAGCTGGCAGGCTGAAGG - Intergenic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932106126 2:68944268-68944290 GGGAGGGACTGGCAGGCAGGTGG + Intergenic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932576792 2:72966784-72966806 CTGTGGGCCTGGCAGCAAGAAGG - Intronic
932594211 2:73084081-73084103 CTGGGGAGCTGGCCGGGAGAGGG - Intronic
932740837 2:74290106-74290128 CTTAGGGAATGGCAGGCACAGGG - Intronic
932784659 2:74589615-74589637 GTGTGGTGCTGGCAGGCAGTGGG + Intronic
932856666 2:75241310-75241332 GGGAAGGGCTGGCAGGCAGGTGG - Intergenic
933250551 2:80024428-80024450 GTAAGGGGGTGTCAGGCAGAGGG + Intronic
933750931 2:85601912-85601934 CTGACAGGCTGACAGGCAGGAGG + Exonic
933876222 2:86623711-86623733 CTGAGTGGCCGGGAGGCAGCCGG - Exonic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
934608884 2:95720101-95720123 CTGAGGGGCTTGTAAACAGATGG + Intergenic
934661025 2:96143792-96143814 CAGTGGGGCAGGCAGGCAGAGGG + Exonic
935203385 2:100877560-100877582 CTGAGGGGAGGGGAGGCTGAAGG - Intronic
935332679 2:101988637-101988659 CTGAGCCACCGGCAGGCAGAGGG + Intergenic
935676381 2:105598090-105598112 CAGAGTGGGAGGCAGGCAGAGGG - Intergenic
936059065 2:109282806-109282828 CTCCAGGGCTGGCAGGCAGGAGG + Intronic
936059394 2:109284448-109284470 CTGGGAGGCAGGCATGCAGAAGG + Intronic
937002080 2:118477114-118477136 CAGGGGGGCAGGCAGGCAGACGG - Intergenic
937094261 2:119225239-119225261 CAGAGGGGCTGGCAAGGAGCAGG + Intronic
937097026 2:119242156-119242178 CTCAGGAGATGGCAGGCAGCGGG + Intronic
937183687 2:120018753-120018775 TTGAGGGGCTGTGAGGCAGAAGG - Intronic
938166145 2:129028672-129028694 CAGAGGGGCTGGCAGTGAGAGGG + Intergenic
938310286 2:130285012-130285034 CTGAGGGGCAGGAAGGCAGAGGG - Intergenic
938408740 2:131046739-131046761 TTGAGGGGCTGGGAGGCGAAGGG - Exonic
938444645 2:131367362-131367384 CTGAGGGGCAGAAAGGCAGAGGG + Intergenic
938792974 2:134692951-134692973 CTGAGGTGCTGGAAGAAAGATGG - Intronic
939577280 2:143911466-143911488 GTCAGGAGCTGGCTGGCAGAAGG - Intergenic
941228188 2:162875373-162875395 GTGGGGGGCTGGCAGGGAGGTGG + Intergenic
941995973 2:171602431-171602453 CTGAGGGATTGGCTGGAAGATGG - Intergenic
942116582 2:172735230-172735252 CTGAGGGGCAGGGAGGGAGGAGG - Intergenic
942323062 2:174752869-174752891 GTGACTTGCTGGCAGGCAGATGG + Intronic
942669719 2:178361884-178361906 ATGGGGGGCTGGCAGGGAGGTGG + Intronic
943266216 2:185736646-185736668 GAAAGGGGCTGTCAGGCAGAGGG + Intergenic
943442508 2:187943325-187943347 TGGAGGGGTTGGCAGGGAGAGGG - Intergenic
944319495 2:198321695-198321717 GTGAGTGTCTGGCAGGCAGCTGG + Intronic
945846976 2:214957311-214957333 CTGAGGAGTTTGCAGGAAGATGG + Intronic
945980925 2:216309997-216310019 CTGAGGAGCTGGCAAGAAGAGGG + Intronic
946021627 2:216644219-216644241 ATGTGGGGCTGGCAGCCAGAAGG - Intronic
946165530 2:217861339-217861361 CTCAGGGACTTGCAGGGAGAGGG - Intronic
946181872 2:217953748-217953770 GGGATGTGCTGGCAGGCAGAGGG + Intronic
946346394 2:219114460-219114482 CTCAGGGGCTTCCAGACAGAAGG + Intronic
947522833 2:230861775-230861797 CGGATGTGCTGGCAGGCAGGAGG + Intergenic
947634878 2:231674915-231674937 CAGAGGGGTTTGCAGGCTGACGG - Intergenic
947739836 2:232480030-232480052 TGGAGGGGCTGGAAGGCAGGTGG + Exonic
947947571 2:234119728-234119750 CTGAGGGGCCTGAAGGCAGGTGG + Intergenic
948392957 2:237625958-237625980 CTCAGCAGCTGGCAGGCAGCAGG + Intergenic
948762331 2:240199722-240199744 CTGGGGGGCGGGAAGGCAGCCGG - Intergenic
1168949155 20:1784692-1784714 TTGTGGGGCTGGAAGGCTGAAGG + Intergenic
1169033470 20:2431040-2431062 CTGGGGGGCTGGCAGGGAATGGG + Intronic
1169500735 20:6158087-6158109 GGAAGGGGCTGGCAGGCAGGAGG + Intergenic
1169817602 20:9674339-9674361 TTGAGGGGTAGGCAGGGAGAGGG - Intronic
1170127187 20:12976807-12976829 GAGAGGGGCTGGCAGACAGAGGG + Intergenic
1170306545 20:14944855-14944877 TTGTGGGACGGGCAGGCAGAAGG - Intronic
1170360866 20:15544835-15544857 CTGAAGGGCTAGAAGTCAGAGGG - Intronic
1170481139 20:16765991-16766013 TTGTGGGGCTGGCAGGGAGCTGG + Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171330860 20:24337753-24337775 CTGAGGGGCTGCCAGGGCCATGG - Intergenic
1172031494 20:31985170-31985192 GGGTGGGGCTGGGAGGCAGATGG - Intronic
1172266529 20:33619967-33619989 CTGAGAGGCTGTCAGACAAAAGG + Intronic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1172865118 20:38089968-38089990 CTGGGGGGCTGGGCGGAAGAAGG - Exonic
1172943466 20:38670662-38670684 GAGAGTGGCTGGCAGGGAGAAGG - Intergenic
1173274995 20:41572654-41572676 CTGATGGGTAGGCATGCAGAAGG - Intronic
1173508336 20:43607112-43607134 CTGGGTGGTTGCCAGGCAGAGGG + Intronic
1173857323 20:46258673-46258695 CTGGGGAGCTGGGAGGCAGGGGG - Intronic
1174077223 20:47946253-47946275 CTGTGGGGGTGGCAGGGAGCAGG + Intergenic
1174600981 20:51724624-51724646 CTGTGGGGCTGACATTCAGAAGG - Intronic
1174672273 20:52319307-52319329 CTGAGGGCCTCTCAGGAAGAAGG + Intergenic
1175278706 20:57788454-57788476 CTGAAGGCCTTCCAGGCAGAGGG - Intergenic
1175612803 20:60365428-60365450 GGGAGGGGCTGGCCGGCTGACGG - Intergenic
1175717317 20:61263807-61263829 CTGAGGAGCTGGGAGGCACAAGG - Intronic
1175758976 20:61548308-61548330 CTGAGGCTCGGGCAGGCAGGTGG + Intronic
1175885405 20:62287876-62287898 CACAGGGCCTGGCAGGCAGGAGG - Intronic
1175913771 20:62416346-62416368 CCCAGGGCCTGGCAGGCAGCAGG + Intronic
1175949755 20:62577045-62577067 CTGAGGGTCTGGGAGTCAGCTGG - Intergenic
1176050448 20:63116567-63116589 CCGAGGCTCTGGCAGGCGGAGGG + Intergenic
1176074802 20:63243578-63243600 CTGACGGGCTGGCGAGCAAAGGG + Intronic
1176139366 20:63538293-63538315 CTCAGGGGCTGGGGGGCAGGCGG - Intergenic
1176852802 21:13935483-13935505 ATGATGGGCGGCCAGGCAGAGGG + Intergenic
1177206569 21:18017429-18017451 CAGAGTGGCTGGAAGGCAAAGGG - Intronic
1178115516 21:29412565-29412587 GTGAGAGGCTGGCAGGAGGAAGG - Intronic
1178436894 21:32567656-32567678 GGGAGGGGCTGGCAGGCAGGTGG + Intergenic
1178450689 21:32696720-32696742 CTGAGGGGCTGGCAGGGAGTTGG - Intronic
1178906727 21:36642761-36642783 CAGAAGGGAGGGCAGGCAGAGGG + Intergenic
1179370786 21:40804494-40804516 GATAGGGGCTAGCAGGCAGAGGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179595164 21:42438391-42438413 ATGAATGGCTGTCAGGCAGAGGG + Intronic
1179948921 21:44698667-44698689 CTGAGGGGCTGGGCTGCAGGTGG - Intronic
1180087376 21:45514060-45514082 CTCAGAGGCAGGCAGGCAGTGGG + Exonic
1180646154 22:17340795-17340817 CTGAGAGGCTGGGAGTCAGGAGG + Intergenic
1180755583 22:18158691-18158713 CTGAGAGGCTGAAAGGCAGAAGG - Intronic
1180859626 22:19070289-19070311 CAGAGGGGCTTTCTGGCAGATGG + Intronic
1181009416 22:20031864-20031886 CTCAGGGGCTGCCAGGCCGTGGG + Intronic
1181277232 22:21694696-21694718 CTGGGGGCCAGGCAGGCAGGGGG + Intronic
1181403461 22:22665768-22665790 ATGAGGGTCAGGCAGGCAGCAGG - Intergenic
1181405774 22:22684198-22684220 ATGAGGGCCAGGCAGGCAGCAGG - Intergenic
1181408466 22:22701752-22701774 ATGAGGGCCAGGCAGGCAGCAGG - Intergenic
1181413787 22:22745251-22745273 ATGAGGGCCAGGCAGGCAGTAGG - Intronic
1181469741 22:23130763-23130785 CTGATGAGGTGTCAGGCAGAGGG + Intronic
1181865118 22:25848578-25848600 ATGATGGGCTGGCAGGGGGATGG + Intronic
1181967773 22:26668643-26668665 GGGAGGGGCTGTCAGGCAGAGGG + Intergenic
1182199361 22:28553538-28553560 CGGGGTGGCTGCCAGGCAGAGGG - Intronic
1182418613 22:30237669-30237691 CTGAGGCCCAGGGAGGCAGAGGG - Intergenic
1182556979 22:31134416-31134438 CTGAGGGTGGGGTAGGCAGATGG + Exonic
1182574283 22:31262432-31262454 CTGACAGGATGCCAGGCAGAGGG + Intronic
1182865584 22:33601420-33601442 CAGAGGGGCTGTCAGGCTGGTGG + Intronic
1182976329 22:34626258-34626280 CGGGGCGGCTGCCAGGCAGAGGG + Intergenic
1183029756 22:35094723-35094745 CTGAGCGGCTGGCTGGTGGAAGG - Intergenic
1183276486 22:36901244-36901266 CTGAGGGGCTGGCTGTCAACAGG - Intergenic
1183371462 22:37434914-37434936 CTCAGGGTCTGGCATGCAGATGG + Intergenic
1183427593 22:37747684-37747706 CTGAGGGCCGGGCAGGCACCCGG - Intronic
1183666548 22:39249428-39249450 GTGAGGGTGAGGCAGGCAGAGGG - Intergenic
1183857568 22:40645986-40646008 CTGAGGGTCAAGCAGGTAGAGGG + Intergenic
1183950333 22:41349097-41349119 CTGGCGGGCGGGCAGGCAGGAGG - Intronic
1184191392 22:42897652-42897674 CTGAGGGACTGCCTGGCAGACGG + Intronic
1184247866 22:43244826-43244848 CTGAGGGGCAGGGAGGAAGAAGG - Intronic
1184640126 22:45866352-45866374 CTGAGGGGCTGGGAGGGAAGCGG - Intergenic
1184669946 22:46007206-46007228 CGCAGGGCCTGGCAGGGAGAGGG + Intergenic
1184932264 22:47690255-47690277 CTGAGGGCTTGGGAGGCAGGAGG + Intergenic
1184982684 22:48105438-48105460 ATGAGGCCCTGGCAGGCAAAGGG + Intergenic
1184991386 22:48172496-48172518 TAGGTGGGCTGGCAGGCAGAGGG - Intergenic
1185343532 22:50301785-50301807 CTGAGGCGCTGACAGGCTGACGG - Intronic
1185377080 22:50487581-50487603 CTGTGGGGCTGCCTGGGAGAGGG + Intronic
950117047 3:10457872-10457894 CTAAGGGGCAGGCAGTGAGAGGG + Intronic
950176353 3:10877575-10877597 CTGAGAGTCTGGAAGTCAGAGGG - Intronic
950212779 3:11136209-11136231 CTGAGGGGCTTGCAGGCACCTGG - Intergenic
950296855 3:11839585-11839607 CTGTGAGGCTGGCAGCAAGATGG - Intronic
950967059 3:17153937-17153959 CTGAGGGGAAGGCAGGTAGGTGG - Intergenic
952347478 3:32502418-32502440 CTGAGGGGCCGCCCGGCGGAAGG + Intronic
953610432 3:44443184-44443206 CTGGGGGGCTGGCATGGGGAAGG + Exonic
953955292 3:47227312-47227334 ATGAGGGGCTGCCAGGTAGAAGG - Intergenic
954445279 3:50542990-50543012 CTGGGAGGCAGGCAGGGAGAAGG + Intergenic
955236523 3:57144393-57144415 CTGATAGGCTGTCAGGAAGATGG - Intronic
955437541 3:58918231-58918253 CCAAGGGGCTGGGAGGCAGTGGG + Intronic
955670062 3:61393591-61393613 CTGGGCGGCTGCCAGGCAGAGGG + Intergenic
955674433 3:61434624-61434646 CGGGGCGGCTGGCGGGCAGAGGG + Intergenic
956270315 3:67443803-67443825 CGGAGTGGTTGCCAGGCAGAGGG - Intronic
956482496 3:69687319-69687341 GGCAGGGCCTGGCAGGCAGATGG - Intergenic
956791121 3:72680841-72680863 CCGTGGGGCTGGCAGGAAGTGGG - Intergenic
957255021 3:77825638-77825660 CTGAGGGGCTTCCAGGCTGCTGG + Intergenic
959419195 3:106111458-106111480 CGGGGCGGCTGGCGGGCAGAGGG + Intergenic
960373878 3:116874640-116874662 ATGAGGGGCTGGAGGGCAGGAGG + Intronic
961009229 3:123424865-123424887 CAAAGGAGCTGACAGGCAGAAGG + Intronic
961192092 3:124970527-124970549 CTGAGTGGCAAGCAGGAAGAGGG - Exonic
961372820 3:126441641-126441663 ACGAGGGGCAGGCAGGCAGGGGG + Intronic
961536287 3:127572982-127573004 GTGAGGGGCTGGGAGGCTCAGGG - Intergenic
962345041 3:134612454-134612476 CTGAGGGGATGCAAGGCTGAGGG + Intronic
962345339 3:134614573-134614595 CAGAGGGGCAGCCAAGCAGAAGG + Intronic
962867774 3:139461844-139461866 CCATGGGCCTGGCAGGCAGAGGG - Intronic
963007186 3:140737393-140737415 CTCAGGGGCTTGCAGGCTGATGG + Intergenic
963284382 3:143418824-143418846 CCCAGGTGCTGGCAGGGAGAAGG + Intronic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
967218792 3:187232043-187232065 CTGAGGGGTATGCAGGCAGGAGG - Intronic
967270575 3:187729152-187729174 ATGGGTGGCTGGCAGGCAGGTGG + Exonic
967884501 3:194323907-194323929 CCGAGGGATGGGCAGGCAGAAGG + Intergenic
968319389 3:197751404-197751426 CGGAGGCGGAGGCAGGCAGATGG + Intronic
968451900 4:679820-679842 CACAGGGCCAGGCAGGCAGATGG - Intronic
968719279 4:2188109-2188131 GGGAGGGGTTGGCAGGGAGATGG - Intronic
968770416 4:2502261-2502283 CTCAGGGTCTGGCAGAGAGAAGG - Intronic
968845099 4:3036629-3036651 CAGAGGGTCAGGCAGGCAGGAGG - Intronic
968850352 4:3074169-3074191 CTGAGGGGCGGGGCGGCTGAGGG - Intergenic
968915381 4:3494958-3494980 CTGACAGGGTGGCAGGCAAAGGG - Intronic
968931435 4:3581607-3581629 CTTCGGGACAGGCAGGCAGAGGG - Intronic
968938587 4:3626260-3626282 CTGAGGGAAAGGCAGGCAGCTGG + Intergenic
968964233 4:3761454-3761476 CTGAGGCCCTGGAAGCCAGAAGG + Intergenic
968975695 4:3821072-3821094 CTGAAGGGCCGGCAGGGACAGGG + Intergenic
969298730 4:6284964-6284986 CTGGGGGGCTGGCAGGGTGACGG + Intronic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
971018927 4:22515616-22515638 CCGAGGGGCTGGCAGGGCGGCGG - Exonic
972165643 4:36280870-36280892 ATGATGCGCTGGCAGGCAGATGG + Intergenic
972939763 4:44182045-44182067 CGGGGTGGCTGCCAGGCAGAGGG - Intronic
976484700 4:85588062-85588084 CTGAGGGGATAACATGCAGAGGG + Intronic
979200981 4:117977728-117977750 GGGAGAGGCTGGCAGACAGAGGG - Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979353301 4:119671541-119671563 CTGAATGGCTGCCTGGCAGATGG + Intergenic
979528161 4:121739400-121739422 TTTAGGGGCTGGCTGGCAAATGG + Intergenic
979564011 4:122134086-122134108 CTGACTGGCTAGTAGGCAGAAGG - Intergenic
980009444 4:127579681-127579703 GGGAGGGGCTGGCGGGCAGGTGG - Intergenic
980883672 4:138739435-138739457 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
981189223 4:141841079-141841101 CTTAGTAGCTGGCAGGTAGAGGG + Intergenic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
982928046 4:161364899-161364921 CTGAGAAGCTGACAGGCAGTGGG - Intergenic
983628747 4:169828478-169828500 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
984615920 4:181897120-181897142 CTTTGGAGCTGGCAGGCTGAAGG - Intergenic
984769083 4:183422147-183422169 CTGAGGTGCTGGGAGGTAGACGG - Intergenic
985489495 5:171154-171176 CTGAGGGCCGGGCAGGCTGTGGG - Intronic
985536270 5:467416-467438 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536284 5:467462-467484 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536310 5:467554-467576 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536324 5:467600-467622 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536338 5:467646-467668 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536352 5:467692-467714 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536378 5:467784-467806 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536432 5:467968-467990 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536446 5:468014-468036 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536475 5:468106-468128 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536489 5:468152-468174 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536546 5:468336-468358 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536561 5:468382-468404 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536576 5:468428-468450 CTGAGGGGATGTCAGACAGGAGG - Intronic
985536591 5:468474-468496 CTGAGGGGATGTCAGACAGGAGG - Intronic
986298277 5:6457220-6457242 AAGAGGGGCTTCCAGGCAGAAGG - Intronic
986552592 5:8974712-8974734 CTGATGGGCTTCCAGGCAGGAGG + Intergenic
986852535 5:11830146-11830168 CTTACGGGCTCACAGGCAGAAGG + Intronic
987075661 5:14379830-14379852 CAGAACGGCTGGAAGGCAGATGG - Intronic
987596023 5:20000074-20000096 GTGAGGGGGTGGGAGGCAGTAGG + Intronic
987855030 5:23410635-23410657 GTTAGGGGCTGGCAGGGGGAGGG - Intergenic
988208585 5:28172863-28172885 CTGAGGGACTGGGAAGCAGGAGG + Intergenic
989379232 5:40797803-40797825 CTGAGGGGCTGGTAGGTACGAGG - Intronic
989633472 5:43511153-43511175 CAGGGCGGCTGCCAGGCAGAGGG - Intronic
990115593 5:52386348-52386370 CTGAGGGGCTGGGAGGGGGCAGG + Intergenic
990582136 5:57174783-57174805 CTGAGGGGGTGGAAGGTACAGGG - Intronic
993086800 5:83373131-83373153 CTCAGGGCATGGCAAGCAGAAGG - Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995188716 5:109298295-109298317 CTGAGGTGCTGGCTGGGACAGGG - Intergenic
996386352 5:122913625-122913647 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
996886013 5:128354326-128354348 CTGAGGGGGTGGGAGGCACAGGG + Intronic
997196026 5:131980638-131980660 CTGTGGGGCTGGGAGGCTGAGGG - Intronic
997623014 5:135312150-135312172 CTGAGTGGGTGGCAGCCTGATGG + Intronic
997875013 5:137538437-137538459 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
998162494 5:139821518-139821540 CTGAAGGGCAGGCAGGGACAGGG + Intronic
998643918 5:144041832-144041854 CTGCGGGGCTGGCACGGAGTTGG - Intergenic
999124893 5:149239682-149239704 CCGAGGGTCTAGCAGGCAGGTGG - Intronic
999156951 5:149464885-149464907 GTGAGGGTCTGGCTGGAAGATGG - Intergenic
999311985 5:150557540-150557562 CTGAGGGCCTGGGAGGAAGATGG - Exonic
999430707 5:151522856-151522878 CTGATGGGCTGGCACGCGCAGGG + Intronic
999452215 5:151686865-151686887 CTCAGTGGCAGGCAGGCAGGCGG + Exonic
999987008 5:157014295-157014317 CGGGGTGGCTGCCAGGCAGAGGG - Intergenic
1000398984 5:160805619-160805641 CTGGGGCCCTGGCAGGCAGGCGG - Intronic
1001281929 5:170392234-170392256 CTGGGAGGCTGGCAGGCTGGGGG - Intronic
1001385113 5:171332100-171332122 CTGAGGGCCTGAGAGGCACAGGG - Intergenic
1001525392 5:172425246-172425268 CAGAGGGCCTGGCATGCAGTCGG - Intronic
1001562374 5:172677973-172677995 CTCAGGGTCTGACAGGCTGAAGG - Intronic
1002427839 5:179186335-179186357 CTGAGAGGCTGGACAGCAGAAGG - Intronic
1002626156 5:180531188-180531210 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
1002803444 6:549058-549080 CTGTGGGGGCGGCACGCAGAGGG + Intronic
1002954268 6:1846545-1846567 CTAAGAGGCTGGCAGGGACAGGG + Intronic
1003125980 6:3356239-3356261 CCCAAGGGCTGGCACGCAGAAGG - Intronic
1003816842 6:9851251-9851273 GTGAGGGCCTGGCAGGCATGGGG - Intronic
1005200318 6:23337084-23337106 CTAAGGGGGTGGCAAGTAGAGGG + Intergenic
1005327762 6:24719797-24719819 CTGCGGGGGTGGAAGGCAGGTGG - Exonic
1005929819 6:30475235-30475257 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
1006232474 6:32596197-32596219 CTGGGTGGTTGCCAGGCAGAGGG + Intergenic
1006284345 6:33081336-33081358 CTGATGGGCAGGTAGACAGAAGG + Intronic
1006346314 6:33485801-33485823 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
1006518228 6:34556214-34556236 CTGAGGGGCTTGCAGGGAGCTGG + Exonic
1006544936 6:34772765-34772787 GGGAGGGGAGGGCAGGCAGAGGG - Intronic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1006750191 6:36372204-36372226 GAGAGGGGATGCCAGGCAGAGGG + Intronic
1006809876 6:36813011-36813033 CTCAAGGCCAGGCAGGCAGAGGG + Intronic
1006931045 6:37688667-37688689 CAGAGAGGGTGGCAGGCAGATGG - Intronic
1007207660 6:40165539-40165561 CTCAGGGGCTGTCTGGCAGAAGG + Intergenic
1007294644 6:40812684-40812706 TACAGGGGCTGGCAGACAGAAGG + Intergenic
1007385075 6:41514961-41514983 CAGAGGGGCTGGAAGGCTGGGGG + Intergenic
1007777197 6:44230390-44230412 CCGTGTAGCTGGCAGGCAGAAGG - Exonic
1008377628 6:50810052-50810074 CAGGGTGGCTGCCAGGCAGAGGG + Intergenic
1008836456 6:55837790-55837812 GTGGGAGGCTGGCAGGGAGATGG - Intronic
1011232045 6:85173294-85173316 GTGAGGGGCTGGCAGGAAGGTGG - Intergenic
1011723582 6:90184819-90184841 CTAAGGGGGTGGCAAACAGAGGG + Intronic
1012436492 6:99220169-99220191 ATCAGGGGCTCACAGGCAGATGG - Intergenic
1012713552 6:102639165-102639187 GTGAGGGGCTCGGAGGCAGGTGG + Intergenic
1013626624 6:111943985-111944007 CTGAGGGGGTTGAAAGCAGAAGG + Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014883929 6:126756651-126756673 TTGAGTGGCTGGGATGCAGAGGG - Intergenic
1016840449 6:148519713-148519735 CTGGGGGGCTGGCCGGAAGTTGG + Exonic
1017125495 6:151060542-151060564 ATGGGGGGCTGGCAGGGATAGGG + Intronic
1017352581 6:153459371-153459393 GGGAGGGGCTGGCAGGCAGGTGG + Intergenic
1018144914 6:160877072-160877094 AGGAGGGGCTGGCAGGCAGGTGG - Intergenic
1018919735 6:168163249-168163271 CTGAGGGGCTCGCTGGCTGACGG + Intergenic
1019286016 7:223514-223536 CAGAGGGGCAGGCGGGCACATGG + Intronic
1019440929 7:1046402-1046424 CAGAGGAGCTGGCAGGCAGGAGG - Intronic
1019474389 7:1236869-1236891 CGGCGGGGCTGGGAGGCCGAGGG - Exonic
1019476698 7:1247773-1247795 CAGAGGGGCGGGAAGGCGGAAGG + Intergenic
1019516414 7:1442165-1442187 GTAAGGGGCTGGGAGGCAGGAGG - Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019691106 7:2413213-2413235 CGGAGGGACTGGGAGGAAGAGGG - Intronic
1019705540 7:2495658-2495680 CTGAGGGCCGGGCAGGCACAGGG - Intergenic
1019770937 7:2883306-2883328 CAGAGGGGCTGGCAGGCGTGAGG + Intergenic
1019895046 7:3976613-3976635 CTGCGAGGCTGCCACGCAGAGGG + Intronic
1019895197 7:3977198-3977220 CTGCGAGGCTGCCACGCAGAGGG + Intronic
1020086273 7:5312533-5312555 CTGCCGGGCTGGCAGGAAGGCGG + Exonic
1020204723 7:6105379-6105401 CTGGGGGCCGGGCAGGCAGGCGG + Intronic
1020800203 7:12723689-12723711 CTGAGTGGCTGATGGGCAGAAGG - Intergenic
1021174262 7:17432506-17432528 ATGAGGTGATTGCAGGCAGATGG - Intergenic
1022134921 7:27438156-27438178 CTGAGGGGTTTCCAGGCACATGG - Intergenic
1022283762 7:28935615-28935637 CTGGGGGTGGGGCAGGCAGAGGG + Intergenic
1023697104 7:42858866-42858888 GGGAGGAACTGGCAGGCAGAGGG - Intergenic
1023965293 7:44960915-44960937 CTGAGGGGCTGAGGGGCTGAGGG + Intergenic
1023965612 7:44961881-44961903 CTGAGGGGCTGAGAGGCTGAAGG + Intergenic
1024049428 7:45609440-45609462 CGGAGGGGCTTGGAGCCAGAGGG + Intronic
1024277360 7:47688843-47688865 ATGAGAGCCAGGCAGGCAGAGGG - Intergenic
1024797493 7:53036311-53036333 CTCAGGGGCTTGAAGGCAGAGGG - Exonic
1025158445 7:56631067-56631089 CTGAAGCCCTTGCAGGCAGAAGG + Intergenic
1025996000 7:66528038-66528060 CTGAGTGGCAGGCAGGCATCTGG + Intergenic
1025998614 7:66544128-66544150 CTGAGGGTCTCCCAGCCAGAGGG - Intergenic
1026156137 7:67827420-67827442 CTGAGGGGCCACAAGGCAGAAGG - Intergenic
1026743604 7:72994360-72994382 CTGAGTGGCTGGAAGGCGAAGGG + Intergenic
1026771290 7:73201581-73201603 CTGGGGGGCTGGAAGACAAAGGG - Intergenic
1026783686 7:73285827-73285849 CTGAGTGGCTGGAAGGCCAAGGG + Intergenic
1026803516 7:73415025-73415047 CTGAGTGGCTGGAAGGCCAAGGG + Intergenic
1026951455 7:74349988-74350010 GTCAGGGGCTGTCAGGAAGATGG + Intronic
1026991572 7:74588965-74588987 CTGAGGGGCTCCCAGCCAGAGGG - Intronic
1027012157 7:74754978-74755000 CTGGGGGGCTGGAAGACAAAGGG - Intronic
1027029711 7:74879059-74879081 CTGAGTGGCTGGAAGGCCAAGGG + Intergenic
1027075884 7:75191076-75191098 CTGGGGGGCTGGAAGACAAAGGG + Intergenic
1027100132 7:75370717-75370739 CTGAGTGGCTGGAAGGCCAAGGG - Intergenic
1027202363 7:76072071-76072093 CTGGGAGGCTGGCAGGAACACGG + Intergenic
1027260643 7:76462127-76462149 CTGAGGGGCTCGCAGGCGGAGGG + Intronic
1027312022 7:76960240-76960262 CTGAGGGGCTCGCAGGCGGAGGG + Intergenic
1027965336 7:84998613-84998635 CTGATGGGAAGGCATGCAGATGG - Exonic
1028762618 7:94511122-94511144 GAGAGAGGCTGACAGGCAGAGGG + Intronic
1029274804 7:99397691-99397713 CCGAGGGAGTGGCAGGCACAGGG + Intronic
1029561971 7:101308797-101308819 CTGAGGGCCAGGGAGGGAGAGGG + Intergenic
1029593880 7:101526428-101526450 CAGAGGGGTCTGCAGGCAGAGGG - Intronic
1029595823 7:101537224-101537246 GGGACAGGCTGGCAGGCAGAAGG + Intronic
1029663380 7:101978595-101978617 CAGAGGGTCTAGCAGGGAGACGG - Intronic
1032491805 7:132329456-132329478 CTGGGGCCCTGGCAGGCACAGGG - Intronic
1033981498 7:147170838-147170860 GGGAGGGGCTGACAGGCAGGCGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034341722 7:150361529-150361551 CTGAGGGCTTGGGAGACAGAGGG + Intergenic
1034421330 7:150992600-150992622 GTGGGGGGCCGGCAGGCGGAAGG - Intronic
1034471461 7:151256818-151256840 ATCAGCTGCTGGCAGGCAGAGGG - Intronic
1034532160 7:151702537-151702559 CTGATGGGCTTCCTGGCAGATGG - Intronic
1034536673 7:151729705-151729727 CTGCGGGGCTGGACGGCAGCAGG - Intronic
1034688891 7:152998271-152998293 AGGAGGGGCTGGAAGTCAGATGG + Intergenic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1035012581 7:155732747-155732769 CCGAGGGCCTTGCAGGCAGAGGG + Intronic
1035620401 8:1032339-1032361 CCGAGTGACAGGCAGGCAGACGG - Intergenic
1036175489 8:6534039-6534061 CTGAGGGGCATGCAGGGAGCTGG - Intronic
1036229003 8:6983730-6983752 CTGAGGAGCTGGGAGGTGGAGGG - Intergenic
1036231456 8:7002835-7002857 CTGAGGAGCTGGGAGGTGGAGGG - Intronic
1036233913 8:7021929-7021951 CTGAGGAGCTGGGAGGTGGAGGG - Intergenic
1036648314 8:10625744-10625766 CAGAGGGCCTGGCAGGAAGCGGG + Intronic
1037563231 8:20093797-20093819 CAGAGGGGCAGGCAGGCAGCAGG + Intergenic
1037756273 8:21712250-21712272 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
1037934717 8:22907792-22907814 CAGAGGTGGTGGCAGGGAGATGG + Intronic
1038319526 8:26514268-26514290 CTTAGGGACTGGCAGACGGACGG + Intronic
1039512809 8:38105340-38105362 CCGCGGGCCTGGCAGGCTGAAGG - Exonic
1039753162 8:40496470-40496492 CGGGGCGGCTGCCAGGCAGAGGG + Intergenic
1039807608 8:41014454-41014476 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
1039883979 8:41645303-41645325 CTGAGCTGCTGGCAGGTAGGGGG - Exonic
1039895516 8:41714089-41714111 CTGAGGGACTGGAAGGTAGCAGG + Intronic
1039961903 8:42254832-42254854 CTGTGGGGCGGCCGGGCAGAGGG - Intergenic
1040052835 8:43033139-43033161 CGGGGCGGCTGCCAGGCAGAGGG + Intronic
1040561214 8:48524633-48524655 CTGAGAGGTTGGCTGGCAGTGGG + Intergenic
1040785472 8:51159163-51159185 CAGAGTGGCTGCCGGGCAGAGGG - Intergenic
1041270455 8:56104698-56104720 CAGGGCGGCTGCCAGGCAGAGGG + Intergenic
1043761611 8:84075744-84075766 GGGAGGGGCTGGCAGTCAAATGG + Intergenic
1043789516 8:84446771-84446793 CTGAGGGGGTGCCATGCAGGGGG + Intronic
1044182207 8:89209865-89209887 CTGAGGAGGAGGCATGCAGATGG - Intergenic
1044306462 8:90645924-90645946 CGGAGGGGCTGGCCGGCTGAGGG - Exonic
1044750112 8:95407751-95407773 CTGAGGGGATGACAGGCAACAGG - Intergenic
1045256807 8:100531969-100531991 CTAAGGCAGTGGCAGGCAGAAGG + Intronic
1045298689 8:100892722-100892744 CGGAGCGGCTGCCAGGCGGAGGG + Intergenic
1046454538 8:114440901-114440923 GGGAGGGGCTGGTGGGCAGAAGG - Intergenic
1047687611 8:127317222-127317244 CGGGGCGGCTGGCGGGCAGAGGG - Intergenic
1048508520 8:135042086-135042108 CTCAGGGGGAGGCAGGCAGGCGG + Intergenic
1048568328 8:135627310-135627332 CTGAGGTTCAGGCAGGAAGAAGG + Intronic
1049047376 8:140163555-140163577 CGGAGAGGGTGGCGGGCAGATGG + Intronic
1049261366 8:141640910-141640932 CTGGGGGGCTGCCAGTCAGATGG - Intergenic
1049407431 8:142457950-142457972 CCAGGGGGCTGGGAGGCAGACGG - Intronic
1049441365 8:142611271-142611293 CTGTGGGGCTGGCAGGGTGTGGG + Exonic
1049451911 8:142666513-142666535 TTCAGGGGCTGGAAAGCAGAGGG + Exonic
1049585718 8:143431489-143431511 CTGAGGGGCTGCCAGCCCGTGGG - Intergenic
1049682732 8:143926929-143926951 GTGAGGGGCTGGCAGGCCTCTGG - Intronic
1049808261 8:144551213-144551235 ATGGGGGGCTGGCAGGCGGCCGG + Intronic
1050677375 9:8071338-8071360 GGGAGGGGCTGTCAGGCAGGAGG + Intergenic
1050726914 9:8660567-8660589 CTGAGGGGCTGGGAGCCAGCTGG - Intronic
1051475664 9:17505902-17505924 GTGTGGTGCTGGCAGGTAGAGGG + Intergenic
1051932714 9:22406240-22406262 GGGAGGAGCTGGCAGGCAGGAGG - Intergenic
1052707556 9:32011120-32011142 CTGTGGGACTGGCAGCCAGCTGG - Intergenic
1053221880 9:36319262-36319284 CTGGGGTGCAGGCCGGCAGACGG + Intergenic
1053416118 9:37947795-37947817 CAGAGAGGATGCCAGGCAGAGGG + Intronic
1054452154 9:65409076-65409098 CTGAGGGAAAGGCAGGCAGCTGG - Intergenic
1055254862 9:74356671-74356693 CTGAGGGGCAGGGAAGGAGATGG + Intergenic
1055955128 9:81766191-81766213 GTGATGGGGTGGAAGGCAGACGG + Intergenic
1056409575 9:86312332-86312354 CTGGGCGGTTGCCAGGCAGAGGG - Intronic
1056798978 9:89678231-89678253 GGGAGGGGGTGGGAGGCAGAGGG + Intergenic
1057279817 9:93701485-93701507 CTTAGGGCCTTGCAGGTAGAGGG + Intergenic
1057964198 9:99487606-99487628 CTGATGGGCTGACCGGCACAGGG - Intergenic
1058908308 9:109498547-109498569 CTGAGGGCCTGGCACACAGTAGG - Intergenic
1060039390 9:120286721-120286743 GTGAGGGCCTGCCTGGCAGAGGG + Intergenic
1060374250 9:123104461-123104483 CTGACAGGCTGACACGCAGATGG + Exonic
1060484359 9:124037719-124037741 CAGAGAGGCTGGGAGCCAGAGGG - Intergenic
1060526580 9:124324334-124324356 CTCAGAGGCTGTCAGGCAGCAGG + Intronic
1061257282 9:129460218-129460240 GGGAGGAGCTGGCAGTCAGAAGG - Intergenic
1061290218 9:129646487-129646509 CTGGGCGGCGGGCAGGCAGCAGG - Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061407063 9:130398341-130398363 CTGAGGGGGTGCCAGGCTCAGGG + Intronic
1061559715 9:131394444-131394466 CTGCGGGGCTGGGAGGCCGCGGG + Intronic
1062003006 9:134226206-134226228 CAGGGGGGCTGGGAGGCAGGGGG + Intergenic
1062027435 9:134347009-134347031 CTGTGGAGGTGGCAGGCAGGTGG + Intronic
1062027477 9:134347149-134347171 CTATGGGGGTGGCAGGCAGGTGG + Intronic
1062384949 9:136305511-136305533 CTGAAGGCCTGGCAGGGAGGTGG - Intronic
1062528360 9:136987813-136987835 GTGAGGGGCTGGCAGCAGGACGG - Intergenic
1185648664 X:1632857-1632879 CTGGGGGGCTGGGAGGCTGGGGG + Intronic
1186215664 X:7297895-7297917 CTAAGGAACTGGGAGGCAGATGG - Intronic
1187300239 X:18041860-18041882 CTCAGTGGCTGACAGGCAGTAGG - Intergenic
1187450514 X:19392249-19392271 CTGAGTGACTGGCTGACAGAGGG - Intronic
1188816999 X:34727898-34727920 CTGAGGAGAAGGCAGGCAGTGGG + Intergenic
1188961652 X:36500583-36500605 GAGAGGGACTGGCAAGCAGAAGG + Intergenic
1190914648 X:54802147-54802169 TTGAGGGGGTGGGAGGGAGATGG + Intergenic
1191662543 X:63666037-63666059 ATGAGAGGCAGCCAGGCAGAAGG + Intronic
1192227993 X:69242545-69242567 ATCATGGGCTGGCAGGCAGCAGG + Intergenic
1192544990 X:72005805-72005827 CTGAGGGGCAGGCATCGAGATGG + Intergenic
1194073005 X:89350772-89350794 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1194210746 X:91066295-91066317 TGGAGGGGCTGGCAGGCAGGGGG - Intergenic
1194579882 X:95659070-95659092 CAGTGTGGCTGTCAGGCAGAGGG - Intergenic
1194611603 X:96051247-96051269 CGGGGTGGCTGCCAGGCAGAGGG + Intergenic
1195036216 X:100972957-100972979 CGGAGTGGTTGCCAGGCAGAGGG + Intronic
1195281573 X:103339745-103339767 CTGAGGGGCCCCCAGGGAGATGG + Intergenic
1195706739 X:107742918-107742940 CTGTGGGGCTGGCAGCCTGTGGG - Intronic
1196211228 X:112997836-112997858 TTAAGGGGGTGGCAGGGAGAAGG + Intergenic
1196778515 X:119362068-119362090 CTGGGCGGTTGCCAGGCAGAGGG - Intergenic
1197028890 X:121789696-121789718 CTGAGGGGCTCCCAGGTTGAAGG - Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1197864958 X:131007990-131008012 CTGTGGGGTTGGCTGGCACAGGG - Intergenic
1198260412 X:134960412-134960434 CGGGGCGGCTGCCAGGCAGAGGG - Intergenic
1199305719 X:146265349-146265371 CTGGGGGCTTGCCAGGCAGAGGG - Intergenic
1199666061 X:150097461-150097483 CTAATGGCCTTGCAGGCAGAAGG - Intergenic
1199964417 X:152807671-152807693 ATGAGGAGCTGGAAAGCAGAAGG + Intergenic
1200075590 X:153549109-153549131 CGGAGGGGCTGGGAGGCAGCGGG + Intronic
1200727245 Y:6686512-6686534 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1200728397 Y:6702287-6702309 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1201240246 Y:11951976-11951998 CTCAGGGGCTGTCAGGAAGAAGG - Intergenic
1201624949 Y:16004559-16004581 CAGGGAGGCTGGCAGGCAGGTGG + Intergenic
1202266715 Y:23027628-23027650 CTGAGGCCCTTGCAGGCAGGAGG - Intergenic
1202419708 Y:24661373-24661395 CTGAGGCCCTTGCAGGCAGGAGG - Intergenic
1202451078 Y:25008711-25008733 CTGAGGCCCTTGCAGGCAGGAGG + Intergenic