ID: 1078359510

View in Genome Browser
Species Human (GRCh38)
Location 11:10657536-10657558
Sequence GGTTTCCCGAAAGGGCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078359510_1078359517 10 Left 1078359510 11:10657536-10657558 CCAAGAAGCCCTTTCGGGAAACC 0: 1
1: 0
2: 1
3: 10
4: 72
Right 1078359517 11:10657569-10657591 CTAGCCTCCACTGACCTTTCTGG 0: 1
1: 0
2: 6
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078359510 Original CRISPR GGTTTCCCGAAAGGGCTTCT TGG (reversed) Intronic
903435260 1:23344343-23344365 GGTTTCCCGGAACTGCTTCCAGG + Intergenic
904170938 1:28592027-28592049 GGCTCCAGGAAAGGGCTTCTGGG + Intronic
905737444 1:40339582-40339604 TGTTTCCAGGAAGGGGTTCTAGG - Intergenic
907932620 1:59014802-59014824 GGCTTCCTGCAAGGGCTTTTGGG - Intergenic
1065770853 10:29076786-29076808 GTTTTCCAGAAATGGCTTTTTGG + Intergenic
1066043932 10:31580087-31580109 GGTTTCATGAAAGTGCATCTAGG + Intergenic
1070778020 10:79121380-79121402 GGGTTCCCGAGGAGGCTTCTGGG + Intronic
1072921710 10:99582387-99582409 GGTTTCTGGGAAGGGCTTCTTGG + Intergenic
1073272136 10:102274260-102274282 GGTTTGCTGAAAGAGGTTCTAGG + Intronic
1074865227 10:117540934-117540956 GGTTTCCCAAAAGAGGTTTTTGG + Intergenic
1078086905 11:8239377-8239399 GGGATCTTGAAAGGGCTTCTGGG + Intronic
1078359510 11:10657536-10657558 GGTTTCCCGAAAGGGCTTCTTGG - Intronic
1080749619 11:35139866-35139888 GTTTTCCAGAAAGGGGTCCTGGG + Intronic
1080769370 11:35326160-35326182 AGTTTCCCCAAAGGCCTTGTTGG - Intronic
1084595912 11:70116934-70116956 GGTTTCCCCAATGCGCTGCTGGG - Intronic
1087902868 11:103662250-103662272 GGTTTTCCAACAGGGCTTCCAGG - Intergenic
1088173257 11:107019613-107019635 AGTATCCCGAAAGGGGTTCCAGG + Intergenic
1090423749 11:126593010-126593032 GGCTTGCACAAAGGGCTTCTAGG + Intronic
1093794197 12:23291662-23291684 GCTTTTAGGAAAGGGCTTCTTGG - Intergenic
1096718131 12:53503151-53503173 GGGTTCCTTGAAGGGCTTCTGGG - Intronic
1103177691 12:118878861-118878883 GGTTTCCAGTAAGGGCTGCTTGG - Intergenic
1106583341 13:31036350-31036372 AGCTTCCCAAAAGGGCTGCTGGG - Intergenic
1107448175 13:40486445-40486467 GGTTTCCCCAAACGGCTCCCTGG + Intergenic
1108044176 13:46367229-46367251 GGTTACCCCACAGGGCTTCCCGG + Intronic
1119883953 14:78124569-78124591 GGTTTGTCTCAAGGGCTTCTGGG + Intergenic
1127976556 15:64001540-64001562 GATTTCCAGAAAGGTCTTCTTGG - Intronic
1133634134 16:7650174-7650196 GATTTCACGAAAGGGCCCCTTGG + Intronic
1141420920 16:83915004-83915026 GGTTTCACCAAATGGCTTCTGGG + Exonic
1141582604 16:85010760-85010782 AGTTGCCTGAAAGGGCATCTGGG - Intronic
1141913160 16:87074837-87074859 TGTCTCCCCAAAGGGCCTCTTGG - Intergenic
1150262084 17:63801981-63802003 GGCTCCCTGAAAGGGGTTCTTGG - Intronic
1152990030 18:354922-354944 GGTTTCCAGGCAGGGCTTTTAGG + Intronic
1155436696 18:25819992-25820014 GGTTTCCCTTTAGGGCCTCTGGG - Intergenic
1165924426 19:39318509-39318531 GGATTCCAGAGAGGACTTCTGGG - Intergenic
1166745685 19:45140869-45140891 TGGTTCCTGAAAGGGCTCCTGGG - Intronic
1168699680 19:58429663-58429685 GCTTTCCAGAAAAGGTTTCTTGG - Intergenic
925758127 2:7154810-7154832 GGTTTCCTGAAATGCCATCTGGG - Intergenic
926125408 2:10268634-10268656 GACTTCCCGAAAGGGTTTCAGGG - Intergenic
929949258 2:46393807-46393829 GATGTCCTGAAAGGGATTCTGGG - Intergenic
942222444 2:173783865-173783887 GGGTTCCCAAGAGGGCTTCTTGG + Intergenic
943088561 2:183346760-183346782 GGTTTTCAGGGAGGGCTTCTTGG - Intergenic
947119568 2:226800340-226800362 GGTTTTTCTAAAGGACTTCTGGG + Intergenic
1173403490 20:42745160-42745182 ATTTTCCAGAAAGGGATTCTGGG + Intronic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1184029182 22:41881474-41881496 GGTTTCAAGAAAGGTTTTCTGGG + Intronic
950944374 3:16929381-16929403 GGTTTCCCAAAAAGACTTCTGGG + Intronic
951803985 3:26625057-26625079 TGTTTCCCTATAGGGCTACTAGG - Intronic
953617163 3:44501616-44501638 AGTTTCCTGGAAGGGCTTCTTGG - Intronic
953625739 3:44569305-44569327 AGTTTCCTGAAAGGGCTTCTTGG + Intronic
954646313 3:52133760-52133782 GGTTTCCCCAGAGGGCTTGCTGG + Intronic
955496467 3:59538488-59538510 GGTTTCCCTAAAGGCCTCCTTGG + Intergenic
956693495 3:71899398-71899420 GCTTTCCACAAAAGGCTTCTGGG - Intergenic
959140740 3:102483674-102483696 GGTTTCTCCAAAGGGCTTTTTGG + Intergenic
959329723 3:104988301-104988323 GGTCTCCCTAAAGGGATTATAGG + Intergenic
960898992 3:122535226-122535248 GATTGCCCCAAAAGGCTTCTTGG + Intronic
962111097 3:132449256-132449278 GGTTTCTCAAAAGTCCTTCTTGG + Intronic
969495739 4:7525243-7525265 GGTCTCTTGAAAGGGGTTCTGGG + Intronic
977692851 4:99935435-99935457 GGATTCCCAGAAGGGCTTGTGGG - Intronic
978722993 4:111935700-111935722 GGTTTCCTGGAAAGGCTTCCTGG + Intergenic
979773744 4:124561808-124561830 AGTTTCCCAAAAGGACTTTTTGG - Intergenic
981423531 4:144578321-144578343 AGTTTCCTGAAGTGGCTTCTTGG - Intergenic
981456203 4:144955946-144955968 GGCTTCCCAAAATGGCTTTTTGG + Intergenic
981718203 4:147772833-147772855 GGTTTCCTGAAAGCTATTCTTGG + Intronic
981989933 4:150906320-150906342 GCTTGCCTGTAAGGGCTTCTTGG - Exonic
983037411 4:162885008-162885030 GGTTTCTGGTGAGGGCTTCTGGG + Intergenic
998503858 5:142656471-142656493 GTTTTCCTTGAAGGGCTTCTTGG - Intronic
998653452 5:144147259-144147281 TTTTTCCCCAAAGGGCTTTTGGG - Intergenic
1007099671 6:39237213-39237235 GGTATTCCCAAAGGGCTGCTGGG - Intergenic
1013295571 6:108755599-108755621 GCTTTCCCAAAACTGCTTCTAGG - Intergenic
1020124124 7:5523312-5523334 GGCTTCCCCAGAGGGCTTCCTGG - Intergenic
1021225856 7:18025491-18025513 TGTTTCCTGAAAGTACTTCTTGG - Intergenic
1022068870 7:26889972-26889994 GGTTTTTTGAAAGTGCTTCTAGG + Intronic
1031748281 7:125535044-125535066 GATCTCCCCAAAGGGCTTCTTGG + Intergenic
1031936638 7:127741977-127741999 GGTTACCAGAAAGGCATTCTGGG - Intronic
1032176039 7:129627061-129627083 GGTTTCCAGAAAGGGAAACTGGG - Intronic
1033590856 7:142807058-142807080 GGACTCCTGAGAGGGCTTCTTGG + Intergenic
1037821616 8:22137853-22137875 GGTTTCACGAAGGAGCTTTTGGG - Intergenic
1043936696 8:86150635-86150657 GGGTACCTGAAAGGGCTGCTGGG - Intronic
1047190423 8:122674321-122674343 GGCTGTCCGAAAAGGCTTCTTGG + Intergenic
1049347871 8:142148333-142148355 GGGTGCCCGAGAGGGCTGCTCGG - Intergenic
1050622712 9:7471433-7471455 AGTTGCCAGAAAGGGCTTCAAGG - Intergenic
1059331033 9:113535986-113536008 GGTTGCCAGGAAGGACTTCTGGG - Intronic
1187265309 X:17726618-17726640 GGTTTCCTGAAAGAGATGCTTGG - Exonic
1192556630 X:72095174-72095196 GTCTGCCCGAAAGAGCTTCTAGG - Intergenic