ID: 1078363563

View in Genome Browser
Species Human (GRCh38)
Location 11:10688712-10688734
Sequence CGATTTCCACCAAGCCGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078363554_1078363563 21 Left 1078363554 11:10688668-10688690 CCCTGCACTCACCAATACCTGGA 0: 1
1: 0
2: 1
3: 11
4: 174
Right 1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1078363550_1078363563 29 Left 1078363550 11:10688660-10688682 CCCCAACACCCTGCACTCACCAA 0: 1
1: 1
2: 0
3: 26
4: 350
Right 1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1078363555_1078363563 20 Left 1078363555 11:10688669-10688691 CCTGCACTCACCAATACCTGGAT 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1078363557_1078363563 4 Left 1078363557 11:10688685-10688707 CCTGGATTCCACCAAGTTCATAC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1078363551_1078363563 28 Left 1078363551 11:10688661-10688683 CCCAACACCCTGCACTCACCAAT 0: 1
1: 0
2: 1
3: 16
4: 263
Right 1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1078363552_1078363563 27 Left 1078363552 11:10688662-10688684 CCAACACCCTGCACTCACCAATA 0: 1
1: 0
2: 0
3: 14
4: 287
Right 1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1078363558_1078363563 -4 Left 1078363558 11:10688693-10688715 CCACCAAGTTCATACAACCCGAT 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1078363559_1078363563 -7 Left 1078363559 11:10688696-10688718 CCAAGTTCATACAACCCGATTTC 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1078363556_1078363563 10 Left 1078363556 11:10688679-10688701 CCAATACCTGGATTCCACCAAGT 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078363563 Original CRISPR CGATTTCCACCAAGCCGTGG TGG Intronic
904628675 1:31824805-31824827 CACTTTCTACCAAGCGGTGGAGG - Intergenic
918904800 1:190478189-190478211 CGATTTGCACGAGGCGGTGGGGG + Intergenic
1069826055 10:71255929-71255951 CGATTTCCTCCCCACCGTGGGGG - Intronic
1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG + Intronic
1090003898 11:122983891-122983913 AGATTTGCACCCAGCCTTGGGGG + Intergenic
1090833185 11:130434097-130434119 TGATTTCCAGCCAGGCGTGGTGG - Intergenic
1091792809 12:3281307-3281329 CGTTCTCCACAAAGGCGTGGTGG - Exonic
1097308609 12:58095241-58095263 TGGTTTCCATCAAGCTGTGGAGG - Intergenic
1097809298 12:64000920-64000942 AGATTTCAACCAACCCTTGGAGG + Intronic
1103852383 12:123941464-123941486 CCATTTCCACCAAGCCTTAGTGG - Intronic
1118154855 14:63229887-63229909 CTATTTCCACCATACCGTGTTGG + Intronic
1122779382 14:104137276-104137298 CGCTTTCCACCCAGCCTGGGGGG - Intergenic
1127286682 15:57539298-57539320 TGCCTTCCACCAAGCCCTGGAGG + Intronic
1140585906 16:76291353-76291375 CCATGTCCACCAGGCAGTGGTGG - Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1146299172 17:31674821-31674843 CAATTTCTACAAAGGCGTGGAGG - Intergenic
1151479519 17:74361959-74361981 CAGTTTCCACCAATCCATGGAGG - Intergenic
1152237489 17:79146182-79146204 CAGTTCCCACCAAGCCATGGAGG + Intronic
1152963577 18:95879-95901 CATTTTCCACCCAGCCGGGGTGG + Intergenic
1159096041 18:63903116-63903138 AGTGTTCCACCAAGCCATGGTGG + Exonic
1160564575 18:79779279-79779301 TGTTTTCCTCCAAGCCGAGGGGG - Intergenic
1162551215 19:11359512-11359534 CGACTGCCACCAAGCCAGGGCGG - Intronic
1164470052 19:28522704-28522726 CCATTTCCTCCAAGTCGGGGGGG - Intergenic
1164905433 19:31963869-31963891 TGATTTCCCCCAAGGGGTGGGGG - Intergenic
1165854950 19:38874143-38874165 TGACTTCCCCCAAGCCCTGGCGG + Intronic
1167549631 19:50151293-50151315 CGATTTCCACCGAGCTGAGCCGG + Intergenic
926599315 2:14824842-14824864 AGAATTCCACCAAGCAGTGAGGG + Intergenic
1172385214 20:34529439-34529461 TGATTTCCAGCCAGGCGTGGTGG + Intronic
1174849542 20:53979299-53979321 CTATTTCCCACAAGCCCTGGAGG - Intronic
950521099 3:13498585-13498607 CCAGTTCCACCAAGCCGGGCTGG - Intronic
959596284 3:108132380-108132402 CCATTTCCACCATGCCATGTGGG + Intergenic
964207349 3:154189065-154189087 CGGTTCCCACCAGGGCGTGGTGG - Intronic
973955473 4:56059148-56059170 AGATTTCCAGCAAGGCTTGGTGG + Intergenic
975318636 4:72983911-72983933 AAATTTCCACCAAGCAGTGCAGG + Intergenic
982107311 4:152022261-152022283 AGATTGCCACCAAGCCTTTGGGG + Intergenic
985268708 4:188174553-188174575 CAATTTTCACCAATCCATGGAGG - Intergenic
986768954 5:10954431-10954453 TGATTTCCACCAAGGCTTCGTGG + Intergenic
1001616707 5:173048670-173048692 TGATTTCCAGCCGGCCGTGGTGG - Intergenic
1019542877 7:1559450-1559472 CGAGTTCCACCCAGCAGTGAAGG - Intronic
1030600817 7:111589662-111589684 CATTCTCCACCAAGCCATGGGGG - Intergenic
1042397551 8:68309599-68309621 CGATTTCCCCAAAGGCTTGGAGG - Intronic
1057501899 9:95602812-95602834 GGATTTCCCACAAGTCGTGGAGG - Intergenic
1059179105 9:112195294-112195316 CTATGTCAACCAAGCAGTGGAGG + Intergenic
1060849594 9:126862694-126862716 CGAGTGCCACAAAGCCATGGGGG - Intronic
1060931129 9:127490107-127490129 CGGTGACCACCAAGCCGTGTAGG - Intronic
1062734522 9:138127847-138127869 CATTTTCCACCCAGCCGTGATGG - Intergenic