ID: 1078367089

View in Genome Browser
Species Human (GRCh38)
Location 11:10715745-10715767
Sequence CAGTGTGGAGGAGGGGGATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078367089_1078367100 4 Left 1078367089 11:10715745-10715767 CCGTATCCCCCTCCTCCACACTG No data
Right 1078367100 11:10715772-10715794 CTTCCAACTCTGCCGGGAAATGG No data
1078367089_1078367103 14 Left 1078367089 11:10715745-10715767 CCGTATCCCCCTCCTCCACACTG No data
Right 1078367103 11:10715782-10715804 TGCCGGGAAATGGAGCAAGAGGG No data
1078367089_1078367104 15 Left 1078367089 11:10715745-10715767 CCGTATCCCCCTCCTCCACACTG No data
Right 1078367104 11:10715783-10715805 GCCGGGAAATGGAGCAAGAGGGG No data
1078367089_1078367098 -3 Left 1078367089 11:10715745-10715767 CCGTATCCCCCTCCTCCACACTG No data
Right 1078367098 11:10715765-10715787 CTGGGAGCTTCCAACTCTGCCGG No data
1078367089_1078367102 13 Left 1078367089 11:10715745-10715767 CCGTATCCCCCTCCTCCACACTG No data
Right 1078367102 11:10715781-10715803 CTGCCGGGAAATGGAGCAAGAGG No data
1078367089_1078367099 -2 Left 1078367089 11:10715745-10715767 CCGTATCCCCCTCCTCCACACTG No data
Right 1078367099 11:10715766-10715788 TGGGAGCTTCCAACTCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078367089 Original CRISPR CAGTGTGGAGGAGGGGGATA CGG (reversed) Intergenic
No off target data available for this crispr