ID: 1078369684

View in Genome Browser
Species Human (GRCh38)
Location 11:10734627-10734649
Sequence TCATGTCTGGGGGATCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078369678_1078369684 -1 Left 1078369678 11:10734605-10734627 CCAGGGCTCAGCGCTTCCTCACT No data
Right 1078369684 11:10734627-10734649 TCATGTCTGGGGGATCAGTGTGG No data
1078369675_1078369684 30 Left 1078369675 11:10734574-10734596 CCTTGAGGTAGCACAAGGCAGCT No data
Right 1078369684 11:10734627-10734649 TCATGTCTGGGGGATCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078369684 Original CRISPR TCATGTCTGGGGGATCAGTG TGG Intergenic
No off target data available for this crispr