ID: 1078369861

View in Genome Browser
Species Human (GRCh38)
Location 11:10735700-10735722
Sequence CTAAGTTTCTCCAAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078369861_1078369869 15 Left 1078369861 11:10735700-10735722 CCCGCCTCCTTGGAGAAACTTAG No data
Right 1078369869 11:10735738-10735760 GGGCCCCACGGTAAGAAAGACGG No data
1078369861_1078369865 -6 Left 1078369861 11:10735700-10735722 CCCGCCTCCTTGGAGAAACTTAG No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369861_1078369867 3 Left 1078369861 11:10735700-10735722 CCCGCCTCCTTGGAGAAACTTAG No data
Right 1078369867 11:10735726-10735748 CATTTCCAACAAGGGCCCCACGG No data
1078369861_1078369866 -5 Left 1078369861 11:10735700-10735722 CCCGCCTCCTTGGAGAAACTTAG No data
Right 1078369866 11:10735718-10735740 CTTAGTGACATTTCCAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078369861 Original CRISPR CTAAGTTTCTCCAAGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr