ID: 1078369865

View in Genome Browser
Species Human (GRCh38)
Location 11:10735717-10735739
Sequence ACTTAGTGACATTTCCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078369856_1078369865 13 Left 1078369856 11:10735681-10735703 CCGTCCTCTGTCCTCTCCTCCCG No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369861_1078369865 -6 Left 1078369861 11:10735700-10735722 CCCGCCTCCTTGGAGAAACTTAG No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369859_1078369865 2 Left 1078369859 11:10735692-10735714 CCTCTCCTCCCGCCTCCTTGGAG No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369863_1078369865 -10 Left 1078369863 11:10735704-10735726 CCTCCTTGGAGAAACTTAGTGAC No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369848_1078369865 28 Left 1078369848 11:10735666-10735688 CCGTCACCCCCACCCCCGTCCTC No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369849_1078369865 22 Left 1078369849 11:10735672-10735694 CCCCCACCCCCGTCCTCTGTCCT No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369860_1078369865 -3 Left 1078369860 11:10735697-10735719 CCTCCCGCCTCCTTGGAGAAACT No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369850_1078369865 21 Left 1078369850 11:10735673-10735695 CCCCACCCCCGTCCTCTGTCCTC No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369855_1078369865 14 Left 1078369855 11:10735680-10735702 CCCGTCCTCTGTCCTCTCCTCCC No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369862_1078369865 -7 Left 1078369862 11:10735701-10735723 CCGCCTCCTTGGAGAAACTTAGT No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369851_1078369865 20 Left 1078369851 11:10735674-10735696 CCCACCCCCGTCCTCTGTCCTCT No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369852_1078369865 19 Left 1078369852 11:10735675-10735697 CCACCCCCGTCCTCTGTCCTCTC No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369857_1078369865 9 Left 1078369857 11:10735685-10735707 CCTCTGTCCTCTCCTCCCGCCTC No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369853_1078369865 16 Left 1078369853 11:10735678-10735700 CCCCCGTCCTCTGTCCTCTCCTC No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data
1078369854_1078369865 15 Left 1078369854 11:10735679-10735701 CCCCGTCCTCTGTCCTCTCCTCC No data
Right 1078369865 11:10735717-10735739 ACTTAGTGACATTTCCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078369865 Original CRISPR ACTTAGTGACATTTCCAACA AGG Intergenic
No off target data available for this crispr