ID: 1078369869

View in Genome Browser
Species Human (GRCh38)
Location 11:10735738-10735760
Sequence GGGCCCCACGGTAAGAAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078369864_1078369869 8 Left 1078369864 11:10735707-10735729 CCTTGGAGAAACTTAGTGACATT No data
Right 1078369869 11:10735738-10735760 GGGCCCCACGGTAAGAAAGACGG No data
1078369859_1078369869 23 Left 1078369859 11:10735692-10735714 CCTCTCCTCCCGCCTCCTTGGAG No data
Right 1078369869 11:10735738-10735760 GGGCCCCACGGTAAGAAAGACGG No data
1078369863_1078369869 11 Left 1078369863 11:10735704-10735726 CCTCCTTGGAGAAACTTAGTGAC No data
Right 1078369869 11:10735738-10735760 GGGCCCCACGGTAAGAAAGACGG No data
1078369861_1078369869 15 Left 1078369861 11:10735700-10735722 CCCGCCTCCTTGGAGAAACTTAG No data
Right 1078369869 11:10735738-10735760 GGGCCCCACGGTAAGAAAGACGG No data
1078369857_1078369869 30 Left 1078369857 11:10735685-10735707 CCTCTGTCCTCTCCTCCCGCCTC No data
Right 1078369869 11:10735738-10735760 GGGCCCCACGGTAAGAAAGACGG No data
1078369862_1078369869 14 Left 1078369862 11:10735701-10735723 CCGCCTCCTTGGAGAAACTTAGT No data
Right 1078369869 11:10735738-10735760 GGGCCCCACGGTAAGAAAGACGG No data
1078369860_1078369869 18 Left 1078369860 11:10735697-10735719 CCTCCCGCCTCCTTGGAGAAACT No data
Right 1078369869 11:10735738-10735760 GGGCCCCACGGTAAGAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078369869 Original CRISPR GGGCCCCACGGTAAGAAAGA CGG Intergenic
No off target data available for this crispr