ID: 1078370011

View in Genome Browser
Species Human (GRCh38)
Location 11:10736584-10736606
Sequence GAGGTTAGCCAGAGGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078370001_1078370011 15 Left 1078370001 11:10736546-10736568 CCAGAAAAGGTGATAGAGGTAGG No data
Right 1078370011 11:10736584-10736606 GAGGTTAGCCAGAGGGGGCAGGG No data
1078370000_1078370011 16 Left 1078370000 11:10736545-10736567 CCCAGAAAAGGTGATAGAGGTAG No data
Right 1078370011 11:10736584-10736606 GAGGTTAGCCAGAGGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078370011 Original CRISPR GAGGTTAGCCAGAGGGGGCA GGG Intergenic
No off target data available for this crispr