ID: 1078393270

View in Genome Browser
Species Human (GRCh38)
Location 11:10955113-10955135
Sequence AAACCATTCAACAAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6457
Summary {0: 335, 1: 1966, 2: 1995, 3: 1255, 4: 906}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078393270_1078393272 -3 Left 1078393270 11:10955113-10955135 CCTAGAGACTTGTTGAATGGTTT 0: 335
1: 1966
2: 1995
3: 1255
4: 906
Right 1078393272 11:10955133-10955155 TTTTGACCAAAATGCTGATAGGG No data
1078393270_1078393275 4 Left 1078393270 11:10955113-10955135 CCTAGAGACTTGTTGAATGGTTT 0: 335
1: 1966
2: 1995
3: 1255
4: 906
Right 1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG No data
1078393270_1078393276 18 Left 1078393270 11:10955113-10955135 CCTAGAGACTTGTTGAATGGTTT 0: 335
1: 1966
2: 1995
3: 1255
4: 906
Right 1078393276 11:10955154-10955176 GGATATGGGTAATGAAGTCCAGG No data
1078393270_1078393274 3 Left 1078393270 11:10955113-10955135 CCTAGAGACTTGTTGAATGGTTT 0: 335
1: 1966
2: 1995
3: 1255
4: 906
Right 1078393274 11:10955139-10955161 CCAAAATGCTGATAGGGATATGG No data
1078393270_1078393277 24 Left 1078393270 11:10955113-10955135 CCTAGAGACTTGTTGAATGGTTT 0: 335
1: 1966
2: 1995
3: 1255
4: 906
Right 1078393277 11:10955160-10955182 GGGTAATGAAGTCCAGGCTGAGG No data
1078393270_1078393271 -4 Left 1078393270 11:10955113-10955135 CCTAGAGACTTGTTGAATGGTTT 0: 335
1: 1966
2: 1995
3: 1255
4: 906
Right 1078393271 11:10955132-10955154 GTTTTGACCAAAATGCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078393270 Original CRISPR AAACCATTCAACAAGTCTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr