ID: 1078393275

View in Genome Browser
Species Human (GRCh38)
Location 11:10955140-10955162
Sequence CAAAATGCTGATAGGGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078393270_1078393275 4 Left 1078393270 11:10955113-10955135 CCTAGAGACTTGTTGAATGGTTT 0: 335
1: 1966
2: 1995
3: 1255
4: 906
Right 1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078393275 Original CRISPR CAAAATGCTGATAGGGATAT GGG Intergenic
No off target data available for this crispr