ID: 1078406044

View in Genome Browser
Species Human (GRCh38)
Location 11:11070888-11070910
Sequence CGCAGGTGGAGGCGGACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078406044_1078406053 24 Left 1078406044 11:11070888-11070910 CCAGGAGTCCGCCTCCACCTGCG No data
Right 1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG No data
1078406044_1078406052 23 Left 1078406044 11:11070888-11070910 CCAGGAGTCCGCCTCCACCTGCG No data
Right 1078406052 11:11070934-11070956 TGGCTCCCCAAAGAGCCCTGTGG No data
1078406044_1078406055 26 Left 1078406044 11:11070888-11070910 CCAGGAGTCCGCCTCCACCTGCG No data
Right 1078406055 11:11070937-11070959 CTCCCCAAAGAGCCCTGTGGGGG No data
1078406044_1078406054 25 Left 1078406044 11:11070888-11070910 CCAGGAGTCCGCCTCCACCTGCG No data
Right 1078406054 11:11070936-11070958 GCTCCCCAAAGAGCCCTGTGGGG No data
1078406044_1078406051 3 Left 1078406044 11:11070888-11070910 CCAGGAGTCCGCCTCCACCTGCG No data
Right 1078406051 11:11070914-11070936 GCATTTTCAGTAGAAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078406044 Original CRISPR CGCAGGTGGAGGCGGACTCC TGG (reversed) Intergenic
No off target data available for this crispr