ID: 1078406047

View in Genome Browser
Species Human (GRCh38)
Location 11:11070896-11070918
Sequence AATGCCACCGCAGGTGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078406047_1078406051 -5 Left 1078406047 11:11070896-11070918 CCGCCTCCACCTGCGGTGGCATT No data
Right 1078406051 11:11070914-11070936 GCATTTTCAGTAGAAACTGCTGG No data
1078406047_1078406055 18 Left 1078406047 11:11070896-11070918 CCGCCTCCACCTGCGGTGGCATT No data
Right 1078406055 11:11070937-11070959 CTCCCCAAAGAGCCCTGTGGGGG No data
1078406047_1078406053 16 Left 1078406047 11:11070896-11070918 CCGCCTCCACCTGCGGTGGCATT No data
Right 1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG No data
1078406047_1078406054 17 Left 1078406047 11:11070896-11070918 CCGCCTCCACCTGCGGTGGCATT No data
Right 1078406054 11:11070936-11070958 GCTCCCCAAAGAGCCCTGTGGGG No data
1078406047_1078406052 15 Left 1078406047 11:11070896-11070918 CCGCCTCCACCTGCGGTGGCATT No data
Right 1078406052 11:11070934-11070956 TGGCTCCCCAAAGAGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078406047 Original CRISPR AATGCCACCGCAGGTGGAGG CGG (reversed) Intergenic
No off target data available for this crispr