ID: 1078406050

View in Genome Browser
Species Human (GRCh38)
Location 11:11070905-11070927
Sequence TCTACTGAAAATGCCACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078406050_1078406055 9 Left 1078406050 11:11070905-11070927 CCTGCGGTGGCATTTTCAGTAGA No data
Right 1078406055 11:11070937-11070959 CTCCCCAAAGAGCCCTGTGGGGG No data
1078406050_1078406052 6 Left 1078406050 11:11070905-11070927 CCTGCGGTGGCATTTTCAGTAGA No data
Right 1078406052 11:11070934-11070956 TGGCTCCCCAAAGAGCCCTGTGG No data
1078406050_1078406053 7 Left 1078406050 11:11070905-11070927 CCTGCGGTGGCATTTTCAGTAGA No data
Right 1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG No data
1078406050_1078406054 8 Left 1078406050 11:11070905-11070927 CCTGCGGTGGCATTTTCAGTAGA No data
Right 1078406054 11:11070936-11070958 GCTCCCCAAAGAGCCCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078406050 Original CRISPR TCTACTGAAAATGCCACCGC AGG (reversed) Intergenic