ID: 1078406053

View in Genome Browser
Species Human (GRCh38)
Location 11:11070935-11070957
Sequence GGCTCCCCAAAGAGCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078406047_1078406053 16 Left 1078406047 11:11070896-11070918 CCGCCTCCACCTGCGGTGGCATT No data
Right 1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG No data
1078406049_1078406053 10 Left 1078406049 11:11070902-11070924 CCACCTGCGGTGGCATTTTCAGT No data
Right 1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG No data
1078406048_1078406053 13 Left 1078406048 11:11070899-11070921 CCTCCACCTGCGGTGGCATTTTC No data
Right 1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG No data
1078406050_1078406053 7 Left 1078406050 11:11070905-11070927 CCTGCGGTGGCATTTTCAGTAGA No data
Right 1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG No data
1078406044_1078406053 24 Left 1078406044 11:11070888-11070910 CCAGGAGTCCGCCTCCACCTGCG No data
Right 1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078406053 Original CRISPR GGCTCCCCAAAGAGCCCTGT GGG Intergenic
No off target data available for this crispr