ID: 1078411178

View in Genome Browser
Species Human (GRCh38)
Location 11:11120098-11120120
Sequence GCCTGAGGTCTGAGAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078411178_1078411185 13 Left 1078411178 11:11120098-11120120 CCTCCCTCTCTCAGACCTCAGGC No data
Right 1078411185 11:11120134-11120156 GACCAAACCCAGCTGGAAGCTGG No data
1078411178_1078411187 16 Left 1078411178 11:11120098-11120120 CCTCCCTCTCTCAGACCTCAGGC No data
Right 1078411187 11:11120137-11120159 CAAACCCAGCTGGAAGCTGGAGG No data
1078411178_1078411183 6 Left 1078411178 11:11120098-11120120 CCTCCCTCTCTCAGACCTCAGGC No data
Right 1078411183 11:11120127-11120149 TTCCTATGACCAAACCCAGCTGG No data
1078411178_1078411190 21 Left 1078411178 11:11120098-11120120 CCTCCCTCTCTCAGACCTCAGGC No data
Right 1078411190 11:11120142-11120164 CCAGCTGGAAGCTGGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078411178 Original CRISPR GCCTGAGGTCTGAGAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr