ID: 1078413431

View in Genome Browser
Species Human (GRCh38)
Location 11:11146555-11146577
Sequence CGGGTGGATCTCAGCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078413420_1078413431 7 Left 1078413420 11:11146525-11146547 CCACCCTCTTCCTCAAGTCCCTG No data
Right 1078413431 11:11146555-11146577 CGGGTGGATCTCAGCTACCAGGG No data
1078413421_1078413431 4 Left 1078413421 11:11146528-11146550 CCCTCTTCCTCAAGTCCCTGCCT No data
Right 1078413431 11:11146555-11146577 CGGGTGGATCTCAGCTACCAGGG No data
1078413422_1078413431 3 Left 1078413422 11:11146529-11146551 CCTCTTCCTCAAGTCCCTGCCTT No data
Right 1078413431 11:11146555-11146577 CGGGTGGATCTCAGCTACCAGGG No data
1078413423_1078413431 -3 Left 1078413423 11:11146535-11146557 CCTCAAGTCCCTGCCTTGCTCGG No data
Right 1078413431 11:11146555-11146577 CGGGTGGATCTCAGCTACCAGGG No data
1078413419_1078413431 16 Left 1078413419 11:11146516-11146538 CCACAAGGGCCACCCTCTTCCTC No data
Right 1078413431 11:11146555-11146577 CGGGTGGATCTCAGCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078413431 Original CRISPR CGGGTGGATCTCAGCTACCA GGG Intergenic