ID: 1078413780

View in Genome Browser
Species Human (GRCh38)
Location 11:11148860-11148882
Sequence GGGGAGAAGCAGAATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078413780_1078413791 16 Left 1078413780 11:11148860-11148882 CCTGCCTCATTCTGCTTCTCCCC No data
Right 1078413791 11:11148899-11148921 CATCCCCTGCCTTTTACTCCAGG No data
1078413780_1078413792 17 Left 1078413780 11:11148860-11148882 CCTGCCTCATTCTGCTTCTCCCC No data
Right 1078413792 11:11148900-11148922 ATCCCCTGCCTTTTACTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078413780 Original CRISPR GGGGAGAAGCAGAATGAGGC AGG (reversed) Intergenic
No off target data available for this crispr