ID: 1078413957

View in Genome Browser
Species Human (GRCh38)
Location 11:11150062-11150084
Sequence CTGTTCTCACAGAGGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078413947_1078413957 23 Left 1078413947 11:11150016-11150038 CCTCTGCCTGGGATGCTGCTGTT No data
Right 1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG No data
1078413946_1078413957 24 Left 1078413946 11:11150015-11150037 CCCTCTGCCTGGGATGCTGCTGT No data
Right 1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG No data
1078413952_1078413957 -1 Left 1078413952 11:11150040-11150062 CCCACAGCAGAGGTGGAAGAAGC No data
Right 1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG No data
1078413951_1078413957 0 Left 1078413951 11:11150039-11150061 CCCCACAGCAGAGGTGGAAGAAG No data
Right 1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG No data
1078413953_1078413957 -2 Left 1078413953 11:11150041-11150063 CCACAGCAGAGGTGGAAGAAGCT No data
Right 1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG No data
1078413948_1078413957 17 Left 1078413948 11:11150022-11150044 CCTGGGATGCTGCTGTTCCCCAC No data
Right 1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078413957 Original CRISPR CTGTTCTCACAGAGGGGACA TGG Intergenic
No off target data available for this crispr