ID: 1078414051

View in Genome Browser
Species Human (GRCh38)
Location 11:11150666-11150688
Sequence GTTGCAAGCCCCACCTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078414051_1078414055 -6 Left 1078414051 11:11150666-11150688 CCCAAGCAGGTGGGGCTTGCAAC No data
Right 1078414055 11:11150683-11150705 TGCAACCCTGTATCACAGGGTGG No data
1078414051_1078414054 -9 Left 1078414051 11:11150666-11150688 CCCAAGCAGGTGGGGCTTGCAAC No data
Right 1078414054 11:11150680-11150702 GCTTGCAACCCTGTATCACAGGG No data
1078414051_1078414053 -10 Left 1078414051 11:11150666-11150688 CCCAAGCAGGTGGGGCTTGCAAC No data
Right 1078414053 11:11150679-11150701 GGCTTGCAACCCTGTATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078414051 Original CRISPR GTTGCAAGCCCCACCTGCTT GGG (reversed) Intergenic
No off target data available for this crispr