ID: 1078414052

View in Genome Browser
Species Human (GRCh38)
Location 11:11150667-11150689
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078414052_1078414055 -7 Left 1078414052 11:11150667-11150689 CCAAGCAGGTGGGGCTTGCAACC No data
Right 1078414055 11:11150683-11150705 TGCAACCCTGTATCACAGGGTGG No data
1078414052_1078414054 -10 Left 1078414052 11:11150667-11150689 CCAAGCAGGTGGGGCTTGCAACC No data
Right 1078414054 11:11150680-11150702 GCTTGCAACCCTGTATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078414052 Original CRISPR GGTTGCAAGCCCCACCTGCT TGG (reversed) Intergenic
No off target data available for this crispr